Skip to main content

Advertisement

Table 1 Nucleotide sequences of the LAMP primers (licensed patent no. ZL201110346474.8) targeting the mt nad 5 gene

From: Loop-Mediated Isothermal Amplification (LAMP) assay for the identification of Echinococcus multilocularis infections in canine definitive hosts

Primer name Sequence (5′ → 3′)
FIP TTAACCAACCAATAACAACCCAGTgaattc GTGGTGTTAGTTATTTGGTTAGG
BIP ATGTGACGTTTGGTGTGGTAGTTAgaattc AAGAACCACCAAAATAATGTCT
F3 GTGTGTTGCTATATTGCTTGT
B3 AACTTTAACAACATACACCTAGT
  1. Note: The lower case italicized gaattc in the primers FIP and BIP shows the position of the introduced Eco RI restriction site.