Skip to main content

Advertisement

Table 1 The primers and gene ID, used for RT-PCR analysis

From: Analysis of differentially expressed genes in two immunologically distinct strains of Eimeria maxima using suppression subtractive hybridization and dot-blot hybridization

Gene ID Forward primer (5′-3′) Reverse primer (5′-3′)
  S36 ACACAGCGACCAGTCCTCT GAA AGC CGT CTC CGA AGC
  S229 CACCCGTGTTTCCATGAGAG CGACAATTCCCATCG AAGAT
  S231 GCCGTCGTCGCTTTAGATATG CACACGGCATCCACTTCAG
  S251 CATGTTGCAAAGTAGCACTGT TGGCTGTCGAGCGAGAAT
  N140 CTGCTTCACCCTTTGCAC CCTCTCACCAATCATTCTCAC
  N214 CCCTGCAAAGTCGGTCAAG AGCAGCAGAGGCAGCGTTG