Skip to main content

Advertisement

Table 2 The primers and gene ID, used for qRT-PCR analysis

From: Analysis of differentially expressed genes in two immunologically distinct strains of Eimeria maxima using suppression subtractive hybridization and dot-blot hybridization

 Gene ID Forward primer (5′-3′) Reverse primer (5′-3′)
  18 s rRNA CTAACGCAAGGAAGTTTGAGGCA TACAAGAGGCAGGGACGTAATCG
  S36 CAACTCTGAAGCCTGAACTGGC CTGTCATTGTGGACCTTGCAAC
  S251 GTCCAACCGCAATAACATCG CACTTTCGCAACGGAACTCA
  S229 ATTCAGGCACCCGCACTAT TACGGCGGAACTATCACCAAT
  S231 TAGGTTGCTGCTAACCATACAGG CACACGGCATCCACTTCAG
  N140 CTTGCACCGCACAGCATAATGT TCGTCCTGAGTGGAGGCTTTCT
  N214 ATAGTCGGGAATCCAACAACTG GCCAACCCTACTGCTTGCTG