Skip to main content

Table 1 The primers used to amplify the target gene and coding sequence of EnGAM22

From: Cloning and characterization of an Eimeria necatrix gene encoding a gametocyte protein and associated with oocyst wall formation

Gene ID Forward primer (5′-3′) Reverse primer (5′-3′)
En1 ACCCCAAAATAAAATCAAAGGC CCATGAAGATCTCAGACGTAGC
En2 TCGGAATTC GACGGAGCACCTGAG GCGAAGCTT TTAGTTGATGTCGGT