Skip to main content

Advertisement

Table 1 Primers used in this study

From: Estimation of the genome sizes of the chigger mites Leptotrombidium pallidum and Leptotrombidium scutellare based on quantitative PCR and k-mer analysis

Purpose Species Gene Sequence (5’ to 3’) Product size (bp)
Cloning Leptotrombidium pallidum Leptotrombidium scutellare EF1α Fa TATTGATGCTCCTGGTCACAG 850
Rb GAATTTGCAAGCAATGTGAGC
RpS3 F GARGAYGGNTAYTCHGGB 438
R CATRAYYTTNACYTTRATDCC
Standard Drosophila melanogaster RpS3 F CACGTTTCCGATTCGACGTC 925
R CACAACGGACACATTGTCGG
Apis mellifera RpS3 F CTCGTGAACTGTCAGAAGATG 794
R CTGCAAGTGGTATTGGTTGTG
Tetranychus urticae RpS3 F TAGACGAATTCCTTCGTCGAG 553
R AGAAACGTTGTCAGGTAATGGT
Leptotrombidium pallidum Leptotrombidium scutellare EF1α F TTGATGCTCCTGGTCACAGA 842
R GCAAGCAATGTGAGCAGTGT
RpS3 F ATCATCATTCTCGCCACGCG 447
R CTTGTCGCAGTAACACATGCC
qPCR Drosophila melanogaster RpS3 F CATTGAGTTGTACGCCGAGA 127
R ATGTAGCGGAGCACACCATAG
Apis mellifera RpS3 F GTTGTGAAGTGGTTGTTAGTG 132
R GAAGTACATGACGAGTTGCAG
Tetranychus urticae RpS3 F ATGTGAAGTTGTCGTTTCCGG 96
R TTACAAGGGTCACCAGCGTG
Leptotrombidium pallidum EF1α F GTTAAGGAATTGCGCAGAGG 123
R GTAACCGTTGGCGATTTGTC
RpS3 F TCTGACAGAGGCTTGTGTGC 127
R AGCCTTTCGCTCCAGATTCC
Leptotrombidium scutellare EF1α F CCGGAGATTGGAACGAAAGG 120
R TGGACACAACTGAACCACCC
RpS3 F GCACAATGCGAGTCTCTTCG 111
R GACTTCGCAACCTTTCGCTC
  1. aForward primer.
  2. bReverse primer.