Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used in this study

From: Estimation of the genome sizes of the chigger mites Leptotrombidium pallidum and Leptotrombidium scutellare based on quantitative PCR and k-mer analysis

Purpose Species Gene Sequence (5’ to 3’) Product size (bp)
Cloning Leptotrombidium pallidum
Leptotrombidium scutellare
Standard Drosophila melanogaster RpS3 F CACGTTTCCGATTCGACGTC 925
Tetranychus urticae RpS3 F TAGACGAATTCCTTCGTCGAG 553
Leptotrombidium pallidum
Leptotrombidium scutellare
qPCR Drosophila melanogaster RpS3 F CATTGAGTTGTACGCCGAGA 127
Tetranychus urticae RpS3 F ATGTGAAGTTGTCGTTTCCGG 96
Leptotrombidium pallidum EF1α F GTTAAGGAATTGCGCAGAGG 123
Leptotrombidium scutellare EF1α F CCGGAGATTGGAACGAAAGG 120
  1. aForward primer.
  2. bReverse primer.