Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Oligonucleotide primers used for the amplification and sequencing of Babesia orientalis HSP90-A and HSP90-B genes

From: Identification of two novel HSP90 proteins in Babesia orientalis: molecular characterization, and computational analyses of their structure, function, antigenicity and inhibitor interaction

Primer Sequence (5′-3′) Remarks
BoHSP90-A gene
1HSP90-Fa ATGACGGCTGGGGGAGCTCTG Primers for amplification of ORF
1HSP90F1a CAAAACGAGCAGACCTTCCC Primers for Sequencing
BoHSP90-B gene
2HSP90-Fa ATGAAGCGGTCCATATTTTTC Primers for amplification of ORF
  1. Superscript a and b are indicating sense and antisense primers, respectively.