Skip to main content

Advertisement

Table 1 Oligonucleotide primers used for the amplification and sequencing of Babesia orientalis HSP90-A and HSP90-B genes

From: Identification of two novel HSP90 proteins in Babesia orientalis: molecular characterization, and computational analyses of their structure, function, antigenicity and inhibitor interaction

Primer Sequence (5′-3′) Remarks
BoHSP90-A gene
1HSP90-Fa ATGACGGCTGGGGGAGCTCTG Primers for amplification of ORF
1HSP90-R b TTAAGCAGCCACAGTGGGTGATTGC
1HSP90F1a CAAAACGAGCAGACCTTCCC Primers for Sequencing
1HSP90F2a CCCGAATGTGACGACTATTTGGA
1HSP90F3a CTTTTAAGGCTTATGATGACCC
1HSP90F4a GCGCTTGAACCTGTTGATGAG
1HSP90R1 b GCCGTATCAAGACTTTCTGCCT
1HSP90R2 b GAAACCAACACCGAACTGACC
1HSP90R3 b TAACATGTTCCCATTCGTGACG
1HSP90R4 b CGGGTTGTTTTGGCTTCATACG
BoHSP90-B gene
2HSP90-Fa ATGAAGCGGTCCATATTTTTC Primers for amplification of ORF
2HSP90-R b TCAAAGTTCGTCATTGACGG
2HSP90F1a GGCTATTAGGATCAGGGTATCT Primers for Sequencing
2HSP90F2a TATCAGCGGTTCCCATTCAAAC
2HSP90F3a CAAGAAGAAGCTCCAGGAAGA
2HSP90F4a GAAGGATGACGATATGAACTC
2HSP90R1b TCCCGATTTGGCAATTGTT
2HSP90R2 b TGTTTTCGATGCTCTCTTTCAT
2HSP90R3 b CCCCAGTCAGAAACAACAACA
  1. Superscript a and b are indicating sense and antisense primers, respectively.