Skip to main content

Table 1 Sequences of primers and probes used for the detection of Plasmodium species and W. bancrofti using multiplex real-time PCR

From: Diversity of Anopheles mosquitoes in Binh Phuoc and Dak Nong Provinces of Vietnam and their relation to disease

Name Sequence (5′ - 3′) Target
Plasmo 1 GTTAAGGGAGTGAAGACGA TCAGA Plasmodium sp. and P. knowlesi
Plasmo 2 AACCCAAAGACTTTGATTTC TCATAA
Plasprobe FAM-ACCGTCGTAATCTTAACCATAAACTATGCCGACTAG-BHQ1
Pk probe HEX-CTCTCCGGAGATTAGAACTCTTAGATTGCT-BHQ1
FAL_F CTT TTG AGA GGT TTT GTT ACT TTG AGT AA Plasmodium falciparum
FAL_R TAT TCC ATG CTG TAG TAT TCA AAC ACA A
FAL_PB FAM - TGT TCA TAA CAG ACG GGT AGT CAT GAT TGA GTT CA - BHQ1
VIV_F ACG CTT CTA GCT TAA TCC ACA TAA CT Plasmodium vivax
VIV_R ATT TAC TCA AAG TAA CAA GGA CTT CCA AGC
VIV_PB HEX - TTC GTA TCG ACT TTG TGC GCA TTT TGC - BHQ1
LDR1_F ATT TTG ATC ATC TGG GAA CGT TAA TA Wuchereria bancrofti
LDR2_R CGA CTG TCT AAT CCA TTC AGA GTG A
WB_PB Cy5 - ATC TGC CCA TAG AAA TAA CTA CGG TGG ATC TCT G - BHQ2