Skip to main content

Table 1 Sequences of primers used to amplify PCR fragments from Psoroptes cuniculi

From: The complete mitochondrial genome of the scab mite Psoroptes cuniculi (Arthropoda: Arachnida) provides insights into Acari phylogeny

Primer Sequence (5′ to 3′)
COIF GGTCAACAAATCATAAAGATATTGG
COIR TAAACTTCAGGGTGACCAAAAAATC
COI-COIIF TTAATTCTACATTCTTTGACC
COI-COIIR GGAGAACTAGAATCTTGAAA
COII-ND3R TTTCAAGATTCTAGTTCTCC
COII-ND3F ACTCATAACARGTGGCTAAT
ND3-12SR TTCTATTAGCCACCTGTT
ND3-12SF AGTAACTCATTGGAAACC
12S-ND1R AAACTAGGATTAGATACCA
12S-ND1F ATTGCTTTTTTTACWTTAGT
ND1-ND4F GCAGATAGGCTTATGACG
ND1-ND4R AGAAAACAAAATAAAGGTAGG
ND4F TGRCTTCCTAAAGCTCATG
ND4R ATCTCAGAAAAAAAVGWTATAAAA
ND4-CytbF TAGTGTTCATCTTTGACTTCC
ND4-CytbR TACGCCATTTTACGGGCAATTCC
Cytb-COIF CAGGGTTTGCTCCAATTCATGT
Cytb-COIR CCCCTAAAATTGAAGAAATACCAGC