Skip to main content

Table 1 Primer sequences of ABC transporter genes identified in Anopheles stephensi

From: ABC transporters are involved in defense against permethrin insecticide in the malaria vector Anopheles stephensi

Gene Forward primer Reverse primer PCR product size (base pairs) Source
Anst ABCB2 TATCAAGTTCACGGATGTAGAGT TATCCACCTTGCCACTGTC 185 This work
Anst ABCB3 CAACCGTTCCGTAATACTACC ACTGGTAGCCCAATGTGAAG 133 This work
Anst ABCB4 GGACAAAACATTCGGGAGG CGTAGTGAATGTTGTGGCG 109 This work
Anst ABCBmemb6 CTGGAGACGCTGAGAGATA TACTCCTCGGTGAACTGG 125 This work
Anst ABCG4 ATGAGCCCATTCGTCCTG AGCGTGGAGAAGAAGCAG 158 This work
Rps7 AGCAGCAGCAGCACTTGATTTG TAAACGGCTTTCTGCGTCACCC 90 Capone et al. 2013[31]