Skip to main content

Advertisement

Table 2 Characteristics of the selected APVs and the corresponding forward and reverse primers

From: A new multiple-locus variable-number tandem repeat analysis reveals different clusters for Anaplasma phagocytophilum circulating in domestic and wild ruminants

VNTR name BU Length (bp) Genome localization (HZ strain) Gene Primer Sequence 5′ - > 3′ Allele size range (bp) Allele size range (BU) Number of allele
APV-A 201 28845-29712 APH_0032 F TGTAAGCAAGCACCCAACGCGAA 130-865 0,5-4,5 6
     R GCCAGAATCGCAACACACTGACG    
APV-B 114 53792-54393 rpe F GGGGGTATGACGAGTGTGGTAGCAA 0*-945 0*-9 10
     R CCTTACTGCACACCGTACACGCAAA    
APV-C 189 340359-340834 APH_0351 F CCTACGGGGTGTCTTGCGTCCTA 90-1400 0,5-7,5 10
     R CTGCGCGAGTTTATGTGCAACT    
APV-D 123 376959-377498 virB6-3 F ATAGTGTGCAAGGCGCTAGTAATG 355-750 3-6 5
     R TGTCGGACTATGCTTTTCACCATT    
APV-E 15 214596-214852 APH_0215 F CGACCTATGATCGCAGTGTA 5-925 0,5-62 14
     R GTAGCAAGGTAACCACTACCA    
  1. F: forward; R: reverse.
  2. * absence of VNTR.