Skip to main content

Table 1 Sequences of primers used to amplify mitochondrial DNA regions from Chabertia erschowi and Chabertia ovina from China

From: Chabertia erschowi (Nematoda) is a distinct species based on nuclear ribosomal DNA sequences and mitochondrial DNA sequences

Primer Sequence (5′ to 3′)
For rrn S  
CHOF TCGTTTAGTGGGTATGTGTGGTTCT (for C. ovina)
CHOR GCCTACTCCCTAACAAATGACGCTC (for C. ovina)
CHEF GTGGTTTTTAGGTTAGGGTTGAGTG (for C. erschowi)
CHER ACGCTCATACAAAGTAATAAACGCA (for C. erschowi)
For nad 2  
CHOF TTTGTGG(C\T)TAAGAGTGTT(G\A)GCTATT (for C. ovina)
CHOR GAGCCGTAATCAAACATAGTAAATC (for C. ovina)
CHEF TTTGTGG(C\T)TAAGAGTGTT(G\A)GCTATT (for C. erschowi)
CHER ACCGTAATCAAACATAGTAAAATCT (for C. erschowi)
For C. ovina  
COF TGGTTGTGTGGTTTGGGCTCAT
rrnLR ATGTCCTCACGCTAAGACTGCC
rrnLF AGTTTGCTTCTGCCCAGTGA
ND5R ACCGTAACCTCGCCCATCCTG
ND5F ACGGCGTTAGTGGAGGAGGA
ND1R CCACTAACCAACTCCCTTTCACCC
ND1F ATTGGTGCTTTGCGGGCCAGT
ND2R CCATAAACCTTTAAAACCTCCC
ND2F TTGTTGGTTGGGAGACTATG
CYR AAAGGGTCCTCAACCAAACA
CYF CCTGTTTGGGGACCTTCTATTG
COR CCGCAGTAAAATAAGCACGAGA
For C. erschowi  
COF ACCGACGGCTTATGGAAT
rrnLR AGTGCAACCCAACATTATACCCT
rrnLF TAAAGTTTGCTTCTGCCCAGTGATA
ND1R ATAATAGCCAACAAAAGCACCGACA
ND1F CTTGTCGGTGCTTTGCG
CYR CCGCCTCAATAAACATCTC
CYF TGGTCCAGATTATTGAAGG
COR TTACCCGTCAAATACAAAGT