Skip to main content

Table 2 Selected Culex quinquefasciatus primers

From: Population genetics of neotropical Culex quinquefasciatus (Diptera: Culicidae)

Primers Sequence 5′-3′ Allele Size (bp) Number of Alleles
CxqA115 F: GTCGTCAAACTGCCAATAA 86-296 30
R: GCGGAAATAGAACAAACG
CxqGT14 F: TGTTAGCCTAGTGGGAAGGTG 106-200 18
R: AATCCACCATGCACGGATAC
CxqGT108 F: CGTGTTTTATAGGCTTCTTTC 106-316 27
R: TCTTCCTTAACTTTACCCACTC
CxqGA12 F: ACCCGTTCTGGCAACACTG 110-188 17
R: TGGTGCGGATGGACGTT
CxqA118 F: ACCCCGAGCCAACCTTAT 112-254 26
R: CCCCCATTTCACACCTGT
CxqATG9 F:CCACTCAAACTAAAACACCACA 108-300 26
R: AATGCCATAACCATCGTCAT