Skip to main content

Table 1 Primers used to amplify different domains of MIC2 from cDNA of T. gondii tachyzoites

From: Identification of host proteins interacting with the integrin-like A domain of Toxoplasma gondii micronemal protein MIC2 by yeast-two-hybrid screening

Primer name Sequence1 Restriction enzyme sites
pGBKT7-MIC2-F GC CATATG CAGCTGGACATTTGCTTTC NdeI
pGBKT7-MIC2-R TA GTCGAC GACAAGCAGGATACGAACATG SalI
pGBKT7-A/I-R TA GTCGAC TGGCATCCTGGGGGAGTGTCTT SalI
pGBKT7-TSR-F GC CATATG GCCATTTGCTCGGATTGGTC NdeI
  1. 1Restriction enzyme sites were presented in italics. Primers were used in the following combinations for PCR amplifications: pGKBT7-MIC2-F and pGKBT7-MIC2-R were used to amplify MIC2 ectodomain (aa74 - 596); pGBKT7-MIC2-F and pGKBT7-A/I-R were used to amplify the A/I domain (aa74 - 270); and pGKBT7-TSR-F and pGKBT7-MIC2-R were used to amplify the TSR domain (aa271 - 596).