Skip to main content

Advertisement

Table 1 The VNTR loci used in the study and the observed (or predicted for the genome) amplicon sizes from the initial screen for variability

From: Not “out of Nantucket”: Babesia microti in southern New England comprises at least two major populations

Locus Repeat length Repeat motif Primers (5' to 3') Observed size (bp)
     Genome MA WI
BMV1 6 AGTTCT or AGGTCA F- CAATCTATGAGGCATGCGATTC 346 340 340
    R- CTAAAAGGCCCGATGGTTCA    
BMV2 6 TATAAC F-TCCAGTGACAATGACATATTTAAGCA 400 405 392
    R- TGTCCTCATTCTGAGCCACAGT    
BMV4 11 TTAGCTATGGG F- ACCACCACCAGGCCTCTATG 405 361 295
    R- CTGGACCATGATTTGGTTGA    
BMV5 9 GCTGTATTT F- AGGCCCCTGTTCATCACATG 415 317 317
    R- GGAATAGCCTCGAGTCCAGA    
BMV8 10 ACATACAGCG F- AGGCCAGTGGAGCAGAGAAG 262 327 295
    R- CAAGCAATCGTCGCTGTATG    
BMV10 3 GAT F- TTGTTGGTGTCCGGGTTGTA 303 305 298
    R- ATGCTATTGCCTCGCAACCT    
BMV13 15 TCCTTACTAGCCTTA F- ACCGCTCCCGCACTTTAGTA 351 520 443
    R- CCTGCGGGTTCTACCACTCT    
BMV20 6 ATACTA F- CAGGGTTTATGCGAAGAGTGG 713 713 754
    R- GTGCTGCAGGCTTCGATGTA    
BMV23 5 ATATA F- CCGCCTCTCCTATTCCCCTA 322 275 270
    R- GAAGAACAGTTGGATGACTTCG    
  1. MA Massachusetts, WI Wisconsin.