Skip to main content

Advertisement

Table 1 Primers used in this study

From: Defensins from the tick Ixodes scapularis are effective against phytopathogenic fungi and the human bacterial pathogen Listeria grayi

Primer Sequence
Sca3-F 5’-ATGAAGGTCGTTGGAATTGCTCTT-3’
Sca3-R 5’-TTATTTCTGGTAACAGGTGCAAGTTC-3’
Sca6-F 5’-ATGAGGGTCATTGCTGTTACCTTGA-3’
Sca6-R 5’-TTAGTTGTGGTAGCATGTGCACGTC-3’
Actin-F 5’- ATGTGTGACGACGAGGTTGCCGC-3’
Actin-R 5’- GTACAGCGACAGCACGGCCTGG -3’