Skip to main content

Table 1 Primers used to amplify gene fragments for dsRNA synthesis or for qRT-PCR analysis

From: Silencing the buzz: a new approach to population suppression of mosquitoes by feeding larvae double-stranded RNAs

Gene Forward (F); Reverse (R) dsRNA primers qRT-PCR primers
AAEL001033 F TTTCAAGCAACCGGTGACAG ACACTTCGCTCATTCCAC
R TTGAGGGACGTTTTGGAAGC ACCTTGCTGTCTCCATCC
AAEL001156 F GCAAAACTGACCATCCTGCA CGATGTGGACTATACGGAAAC
R CCGTTCTTGCAGTTTCAGCT GGATTACTTGACGGTGCTTC
AAEL001684 F CTGTGCCGGTTATTCAGCTC GGTATTCGTCGGTGGTATCAG
R GGGATGTTGTTGATCGTCGG GCCTCGTGTTCGGTTTCG
AAEL002084 F TTGCTGGACGAGAAGGAAGT AAGGAGTACGAAGAGAAGAAG
R ACTGAGCTGGTTGGTGAAGA CGGAAGCGGTTCATTAGG
AAEL002275 F AGATCGAGCACTGTTTCCGA GTCGTTTGGTGCGGCGTTTG
R CGTATACATGGGCCCGATCT CCTTGTTGTCCTCCTCATCCTTGG
AAEL003501 F CGCAAGGATCGGAAACCAAT CAGCAGGATACGGTCTTC
R CATGCTGTAGATCGGGTTGC GAATAGGTCGGATTGTTGG
AAEL003757 F AAAGGAGCGAAGGAGACCAA GCGGCGGATGCGATTCTC
R AGGTAGTGTTTCAGGGCCTC GACTCTTGGCGGAACGATAGC
AAEL004231 F AGCCAAAGGAAGTACGGTCA GAGCATCAGTCGCACATC
R CTTTCAGCTCTCCGATGTGC TCCTTCTCTCGCAGTAACC
AAEL004471 F CGCGCCAAGAAGAAGATCAA AAGCACAACACCAGGAAC
R ATTTTGTCCCGCAGCATAGC GAAACCATCAGCCAAAGC
AAEL004696 F GATACCGAAATGTGCACGCT CCGTGCTTGAGTTGATAC
R CCGGTTCTTTGTCACTGCAA ATTGGAATCTGATGGTGAG
AAEL004939 F TATCCTGGGCAGCTGAACTC GAACACCACCGCCATCAC
R CAATGCGAGAAGGTACCGTG CCTGCTTCTTCTTGACTTTCG
AAEL005010 F GTTTTCGTCGGTCCGGTTAG CGGTGGAAGTGGATTGTC
R TTGGCTTGGGTCTCCTTGAT CGTTCTGATTCTTGCTGATG
AAEL005975 F TGGACAAGGCGGAACAAAAG GAGCAGAGATGGAGGAAC
R CTTGATTCGAGGCCTCAACG CAGGCGTAACAGTCGTAG
AAEL006726 F GCATTCCTGTTCTCGTTCCC TGGCTTTGGTTCATTGTG
R TGAAGTCACATTTGGCCAGC TATCCGATGTTGGCTTCC
AAEL006841 F CATCGGGTGTTGCTTCTACG ACGGTGCCTATCTGAGAAG
R TCAAAGTACACGTGCTGCAG GGATGCTGATGAACGCTAC
AAEL006975 F GCCATTTCGATGCCAAAACG CGTCTGGTGTAGGTGCTAAGTG
R TCGACTGAAATCCGGGAACA TGCTTGTTCTGCCGCTTGC
AAEL007144 F AACACTTCAACACGTGTCGG TTCGCATACGGAGTGTTAC
R TCGTACACTTCAGCGGAGTT CCTTGTGGATGTAGTCTCG
AAEL007188 F GCAGCGCCAATATCTGAACA TTCGCAGTCGGATTACTTCTTC
R TTCCCGCTTCTTCAGGTGAT TGGTTCTTGGTGATATTCGTAGC
AAEL007434 F CTGTCCTCGCCCAATGAATG TGCGTTCTGTTCATAATGGTTAC
R CTGCAGTAAATCTCCGCACC GTCGGGTTTGGTTTCACTCC
AAEL007544 F ATCGTCTATGGCCGGCTTTA AGTTCTCCTTCCGACATC
R TAGCGCTATGATGTCGTCGT GTAAGCCGCACATTCATC
AAEL007684 F AGCGATGCAGGACGAGATTA CGCCACCAGATGTCCTAATG
R CGTGGGCCAGTTTCTTATCG CAGTTGTTCCGATTGCTTCC
AAEL008428 F TTGGGCATGCTTCACTGATG TGTTGGATGATGTTGTGAGATGTG
R ATCGTCGGAGTATCGCTGTT ATCGTCGGAGTATCGCTGTTC
AAEL008678 F GCCGTTTCCAGGACAACTTT CCAGTCAGAGGGCGAATG
R GTAGTAATCCCGCTCTGCCT CTTCTCCGTCAGGTCATCC
AAEL009047 F GGAACGGTGAAATCGATGGG CACAGAGGAGGAAGTAATTG
R TTCACTGCTGTCGTTGTGTG CACTATTGGACTGCTAACG
AAEL009321 F CAGCGACGAACCACAATGTA GTATATGTCGCCTCGGTTC
R GCTTATCGCCGATGGTTACC GGGTTGTATCGGTGTTCC
AAEL009357 F TCAAGCAAGTGCTGGACAAC Not completed
R TGCCTTCAGGTCGTTCTCTT
AAEL009553 F CAGTAGCTTTCCGTCCATGC GTTGCTCTTCGTCATTATTCC
R GACCAGCGGATAAATCGCAG AAATCCATTGCCATCTTTGC
AAEL010639 F GCGCACGTTATGATGGGAAT GCGGAGATGTTACCTTGAAG
R TTCCCTTGCATCACATCCCT GAAACTACCTGGACCTCTGG
AAEL011098 F TTGGCGAAATTCTGCAAGCT ACTCATACACTCGTTTCAAG
R AGCCGAAACGTTTGCTTCAT TCCATATCCGAAGCACTC
AAEL011310 F GGATATGAGACCCGAACCGT GAAGATGCCGAGCGAGAG
R GTTTTCTTCGGTGCCTTCGT GACCGACCTGGATGGATTC
AAEL012096 F AATACCAGCACGCTCTCTCA Not completed
R ATTGCATCGGTGGCAAGTTT
AAEL012446 F GCTACTTGGATTTGGGCGAC CGGAGCCAAGGAGGTCATC
R ATCGCTTCGGACAGGATGAT ACAGCAGCAGAAGCAGAGG
AAEL013621 F TTTGAACCCGGAAAAGGCAG CCAGAGCAACCGAGAGTATG
R TTCGACGAAATCCTCCCACA CGACGAAATCCTCCCACAG
AAEL013723 F GATGAAACTGCCGCCACTAG TTAAGATTGTCACCTTCACC
R TTGCCGAACCGTTGGAAAAT CGTTGTAGATGTTCTGTCC
AAEL013737 F AAGACTTGGGAAGAGGACGG TGTAGTTCGGTATCGTTCGG
R TTCTCTAGCAGCTGGATCCG TCGGCATTCCTTCGTTCG
AAEL014067 F TTGCTCATACGCTCCATTGC ACAACAGAGCCTAAGACTATC
R TTGCTCCTGAACGGTGAGAT CGACAATCATATTCTCACAGC
AAEL014408 F GACCGATCCTGCAAAAGTCC TGGACGATAATGCTCAAC
R TTTGCTCCTGGGTGTAGAGG GAGGCGAATGGAGTTATG