Table 2 Primers and conditions used for molecular analyses of larvae and snails (according to Lesage et al., 2014 and Steinke et al., 2004 [41,60])
Primer | Sequence (5′-3′) | Initial denaturation | 40 cycles (denaturation/annealing/extension) | Final elongation |
|---|---|---|---|---|
D2 universal | GAAAAGAACTTTGRARAGAGA | 1 cycle of 3 min at 94°C | 94°C for 30 s/40°C for 1 min/68°C for 1 min | 1 cycle of 10 min at 68°C |
(Protostrongylids) | TCCGTGTTTCAAGACGGG | |||
COI universal | GGTCAACAATCATAAAGATATTGG | 94°C for 30 s/48°C for 1 min/68°C for 1 min | ||
(Mollusc) | TAAACTTCAGGGTGACCAAAAAATCA | |||
16S universal | CGGCCGCCTGTTTATCAAAAACAT | 94°C for 30 s/48°C for 40 s/68°C for 40 s | ||
(Mollusc) | GGAGCTCCGGTTTGAACTCAGATC | |||
18S specific | CTGGTTGAT(CT)CTGCCAGT | 94°C for 30 s/52°C for 30 s/68°C for 40 s | ||
(Mollusc) | CTGAGATCCAACTAGGAGCTT | |||
ITS-1 specific | TAACAAGGTTTCCGTAGGTGAA | 94°C for 30 s/52°C for 30 s/68°C for 1 min | ||
(Mollusc) | GCTGCGTTCTTCATCGATGC |