Skip to main content

Advertisement

Table 1 Targeted genes and list of primers used in this study

From: First report of Anaplasma platys infection in red foxes (Vulpes vulpes) and molecular detection of Ehrlichia canis and Leishmania infantum in foxes from Portugal

Pathogen Gene Primer Size (bp) Location in locus/gene Fragment length (bp) References
Anaplasma spp./Ehrlichia spp. 16S E.c-16S fwd TCGCTATTAGATGAGCCTACGT 285-408 123 [28,29]
E.c-16S rev GAGTCTGGACCGTATCTCAGT
Anaplasma spp./Ehrlichia spp. 16S EHR16SD TAGCACTCATCGTTTACAGC 525-870 345 [30]
  EHR16SR GGTACCYACAGAAGAAGTCC
Leishmania spp. ITS ITS-219F AGCTGGATCATTTTCCGATG 219-484 265 [31]
ITS-219R ATCGCGACACGTTATGTGAG