Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 List of known miRNAs expressed and regulated across mosquito developmental stages

From: Dynamic expression of miRNAs across immature and adult stages of the malaria mosquito Anopheles stephensi

S. No. miRNA Length Sequence Tags Per Million (TPM)
1 ast-bantam-3p 22 TGAGATCACTTTGAAAGCTGAT 2199.4 245.4 5410.0 6599.4 9907.7 25521.7
2 ast-bantam-5p 23 CCGGTTTTCATTTTCGATCTGAC 3.3   5.9 7.5 24.0 43.4
3 ast-let-7 21 TGAGGTAGTTGGTTGTATAGT 65.8 5.1 384.4 538.1 983.3 1301.1
4 ast-miR-100 22 AACCCGTAGATCCGAACTTGTG 254.1 30.9 2226.8 2173.4 3732.3 8010.1
5 ast-miR-1000 21 ATATTGTCCTGTCACAGCAGT 8.1 0.6 14.1 19.8 45.6 54.0
6 ast-miR-10-3p 23 CAAATTCGGTTCTAGAGAGGTTT 21.7 7.1 41.1 60.8 67.8 102.0
7 ast-miR-10-5p 22 ACCCTGTAGATCCGAATTTGTT 614.5 151.3 2437.9 3984.4 25072.2 9310.7
8 ast-miR-11 22 CATCACAGTCTGAGTTCTTGCT 218.1 23.8 370.2 574.2 626.4 1269.3
9 ast-miR-1174 22 TCAGATCTACTTCATACCCATG 18.0 2.0 7.9 7.4 6.9 20.6
10 ast-miR-1175-3p 21 TGAGATTCTACTTCTCCGACT 41.6 4.0 50.8 65.1 81.6 66.8
11 ast-miR-1175-5p 22 AAGTGGAGTAGTGGTCTCATCG 9.2   3.2 4.9 3.4 4.2
12 ast-miR-12 23 TGAGTATTACATCAGGTACTGGT 107.4 12.8 128.2 109.3 373.3 438.8
13 ast-miR-124 20 TAAGGCACGCGGTGAATGCC 1.5 0.3 7.2 9.7 40.1 45.1
14 ast-miR-125-3p 21 ACAAGTTTTGATCTCCGGTAT 1.1 0.3 3.6 4.9 3.5 11.0
15 ast-miR-125-5p 22 TCCCTGAGACCCTAACTTGTGA 10.3 1.1 66.7 80.3 228.9 194.0
16 ast-miR-133-3p 22 TTGGTCCCCTTCAACCAGCTGT 9.2 0.3 30.4 42.8 138.3 129.4
17 ast-miR-133-5p 20 AGCTGGTTGACATCGGGTCA     0.2 0.1  
18 ast-miR-137 22 TATTGCTTGAGAATACACGTAG 1.8   5.8 6.4 19.0 39.6
19 ast-miR-13a 22 CTCCTCAAAGGGTTGTGAAATG 0.4   0.4 0.6 1.3 1.3
20 ast-miR-13b-3p 23 TATCACAGCCATTTTGACGAGTT 44.1 9.6 135.1 190.7 138.4 124.9
21 ast-miR-13b-5p 22 TCGTAAAAATGGTTGTGCTGTG 3.7 2.3 6.9 14.3 5.5 18.6
22 ast-miR-1-3p 22 TGGAATGTAAAGAAGTATGGAG 19.5 2.8 243.3 259.6 428.2 197.9
23 ast-miR-14 22 TCAGTCTTTTTCTCTCTCCTAT 89.0 13.6 551.5 690.8 1779.2 4857.7
24 ast-miR-1-5p 18 TACTTCTTTACATTCCAT    0.2 0.4 0.2  
25 ast-miR-184a 22 TGGACGGAGAACTGATAAGGGC 1360.2 161.5 4415.3 4174.1 13173.6 16430.4
26 ast-miR-184b 22 TGGACGGAGAACTGATAAAGGA 22.8   12.0 151.6 76.9 115.5
27 ast-miR-1889 20 CACATTACAGATTGGGATTA    0.1 0.2 1.1 0.9
28 ast-mir-1890 20 TGAAATCTTTGATTAGGTCT 7.7 1.7 126.0 133.4 34.3 38.7
29 ast-miR-1891 22 TGAGGAGTTAATTTGCGTGTTT    0.1 0.3 129.2 85.4
30 ast-miR-190-3p 22 CCCAGGAATCAAACATATTATT    0.5 2.8 13.1 23.4
31 ast-miR-190-5p 24 AGATATGTTTGATATTCTTGGTTG 9.2 4.5 23.0 30.5 57.7 56.8
32 ast-miR-193 20 TACTGGCCTACTAAGTCCCA 0.7   8.4 15.9 0.3 1.1
33 ast-miR-210-3p 21 CTTGTGCGTGTGACAACGGCT 4.0 0.6 6.0 7.5 107.6 291.1
34 ast-miR-210-5p 21 AGCTGCTGACCACTGCACAAG    0.1   0.2 0.5
35 ast-miR-219 20 TGATTGTCCAAACGCAATTC    0.2 0.7 2.4 0.4
36 ast-miR-252-3p 21 CTGCTGCCCAAGTGCTTATCG 0.4   0.5 0.7 3.0 4.4
37 ast-miR-252-5p 22 CTAAGTACTAGTGCCGCAGGAG 60.7 5.7 128.4 166.9 950.6 1111.8
38 ast-mir-263a 22 AATGGCACTGGAAGAATTCACG 2272.9 575.0 831.3 887.0 1205.4 3564.4
39 ast-miR-263b-3p 21 TGGATCTTTTCGTGCCATCGT      0.1  
40 ast-miR-263b-5p 23 CTTGGCACTGGGAGAATTCACAG 5.5 2.3 17.3 25.8 133.4 137.4
41 ast-miR-275 22 TCAGGTACCTGAAGTAGCGCGC 135.0 11.9 286.9 451.9 341.0 711.3
42 ast-miR-276-3p 22 TAGGAACTTCATACCGTGCTCT 1118.3 136.9 2720.4 3464.7 3892.3 4702.5
43 ast-miR-2765 22 TGGTAACTCCACCACCGTTGGC 157.0 21.5 956.6 858.5 2.1 0.5
44 ast-miR-276-5p 22 AGCGAGGTATAGAGTTCCTACG 12.9 2.6 29.6 39.5 31.2 29.2
45 ast-miR-277 22 TAAATGCACTATCTGGTACGAC 36.8 6.0 605.0 657.4 3277.0 5776.7
46 ast-miR-278 21 TCGGTGGGACTTTCGTCCGTT 15.1 2.6 12.7 22.9 25.6 24.3
47 ast-miR-279 20 TGACTAGATCCACACTCATT 44.1 5.7 174.4 264.0 172.4 176.1
48 ast-miR-2796-3p 20 GTAGGCCGGCGGAAACTACT 2.6 0.6 3.2 4.3 20.1 25.7
49 ast-miR-2796-5p 22 AGGGGTTTCTTTCGGCCTCCAG    0.1 0.1 0.1 0.2
50 ast-mir-281-3p 22 TGTCATGGAATTGCTCTCTTTA 36.0 4.0 31.3 38.1 74.2 29.0
51 ast-miR-281-5p 22 AAGAGAGCTATCCGTCGACAGT 3986.2 233.8 4066.0 3725.7 14959.7 13394.8
52 ast-miR-282 22 TAGCCTCTTCTAGGCTTTGTCT 8.1 0.3 6.8 10.2 0.3 0.9
53 ast-miR-283 19 AAATATCAGCTGGTAATTC 1.8 0.6 2.4 2.7 6.8 5.5
54 ast-miR-285 22 TAGCACCATTCGAAATCAGTAC    51.4 14.2 313.7 4.2
55 ast-miR-286 25 TGACTAGACCGAACACTCGCGTCCT     0.1 0.1  
56 ast-miR-2944a-3p 22 TATCACAGTAGTTGTACTTTAA    0.1   0.2  
57 ast-miR-2944a-5p 22 GAAGGAACTTCTGCTGTGATCT    0.4 1.3 0.8 0.4
58 ast-miR-2944b-3p 22 TATCACAGCAGTAGTTACCTGA     0.1 0.0  
59 ast-miR-2944b-5p 23 GAAGGAACTCCCGGTGTGATATA    0.1 0.1 0.1 0.2
60 ast-miR-2945 19 TGACTAGAGGCAGACTCGT 0.4   1.6 2.5 3.5 4.7
61 ast-miR-2a-3p 23 TATCACAGCCAGCTTTGAAGAGC 110.3 13.3 280.0 375.7 475.8 601.6
62 ast-miR-2a-5p 21 ACTCTCAAAGTGGTTGTGAAA 14.0 2.0 79.0 35.4 8.8 36.5
63 ast-miR-2b 24 TATCACAGCCAGCTTTGATGAGCT 51.5 8.5 139.2 307.4 295.8 225.8
64 ast-miR-2c 18 TCACAGCCAGCTTTGATG 7.4   0.2 0.8 4.3  
65 ast-miR-305-3p 22 CGGCACATGTTGGAGTACACTT 5.1 0.3 8.8 8.8 20.8 21.9
66 ast-miR-305-5p 21 ATTGTACTTCATCAGGTGCTC 95.2 9.9 189.8 288.3 168.4 277.6
67 ast-miR-306 22 TCAGGTACTGGATGACTCTCAG 410.0 39.4 556.8 792.3 845.3 2160.1
68 ast-miR-307-3p 20 TCACAACCTCCTTGAGTGAG    0.3 0.6 1.2 1.5
69 ast-miR-307-5p 20 ACTCACTCAACCTGGGTGTG    0.1 0.1 0.1 0.2
70 ast-miR-308 18 AATCACAGGAGTATACTG 32.4 2.6 22.7 30.4 13.0 24.5
71 ast-miR-309 22 TCACTGGGCAAAGTTTGTCGCA     0.1   
72 ast-miR-31 21 TGGCAAGATGTTGGCATAGCT 14.0 2.8 48.6 53.6 104.0 63.7
73 ast-miR-315 23 TTTTGATTGTTGCTCAGAAAGCC 129.1 34.6 75.8 129.8 382.3 980.6
74 ast-miR-317 25 TGAACACATCTGGTGGTATCTCAGT 111.8 17.6 60.2 47.6 480.5 1900.9
75 ast-miR-33 21 GTGCATTGTAGTTGCATTGCA   0.3 0.2 0.2 0.6 0.5
76 ast-miR-34 23 TGGCAGTGTGGTTAGCTGGTTGT 18.0 2.8 8.5 8.0 789.4 657.3
77 ast-miR-375 22 TTTGTTCGTTTGGCTCGAGTTA 72.1 6.0 8.5 11.6 55.5 145.1
78 ast-miR-7 21 TGGAAGACTAGTGATTTTGTT 8.5 2.3 1.9 2.4 13.6 2.9
79 ast-miR-71-3p 22 TCTCACTACCTTGTCTTTCATG 26.5 2.8 64.8 80.9 97.0 98.0
80 ast-miR-71-5p 22 AGAAAGACATGGGTAGTGAGAT 1.1   5.6 5.6 15.3 8.4
81 ast-miR-79-3p 23 ATAAAGCTAGATTACCAAAGCAT 0.4 0.6 1.5 3.0 2.3 3.8
82 ast-miR-79-5p 23 GCTTTGGCGCTTTAGCTGTATGA    0.3 0.6 0.2 0.5
83 ast-miR-8-3p 23 TAATACTGTCAGGTAAAGATGTC 4190.3 577.3 3906.2 5280.5 8065.6 24812.4
84 ast-miR-8-5p 22 CATCTTACCGGGCAGCATTAGA 130.2 13.6 230.3 285.7 901.1 2144.5
85 ast-miR-87 19 GTGAGCAAATATTCAGGTG 0.4   0.2 0.2 1.3 1.3
86 ast-miR-927-3p 22 CAAAGCGTTTGGATTCTGAAAC 4.0 0.9 11.8 15.3 50.7 126.7
87 ast-miR-927-5p 22 TTTAGAATTCCTACGCTTTACC 22.8 7.1 146.7 97.7 866.4 934.0
88 ast-miR-929-3p 20 TCCCTAACGGAGTCAGATTG      0.2 0.4
89 ast-miR-929-5p 21 AAATTGACTCTAGTAGGGAGT 0.4   4.2 4.3 13.5 15.5
90 ast-miR-92a 20 TATTGCACTTGTCCCGGCCT 36.4 1.7 33.1 21.3 29.7 91.3
91 ast-miR-92b 22 AATTGCACTTGTCCCGGCCTGC 192.0 11.9 283.7 339.2 147.6 218.3
92 ast-miR-932 23 TCAATTCCGTAGTGCATTGCAGT 4.8 0.9 22.7 28.1 55.7 80.9
93 ast-miR-957 22 TGAAACCGTCCAAAACTGAGGC 68.4 24.4 268.1 366.7 898.2 819.6
94 ast-miR-965 22 TAAGCGTATAGCTTTTCCCATT 1.1   2.0 2.8 0.8 2.0
95 ast-miR-970-3p 21 TCATAAGACACACGCGGCTAT 43.4 3.4 75.9 131.4 313.4 453.4
96 ast-miR-980 19 TAGCTGCCTAGTGAAGGGC 0.4   1.6 1.9 13.3 37.8
97 ast-miR-981 22 TTCGTTGTCGACGAAACCTGCA 4.8 0.9 8.2 17.3 63.0 49.1
98 ast-miR-988-3p 22 CCCCTTGTTGCAAACCTCACGC    2.5 8.3 12.1 27.6
99 ast-miR-988-5p 21 GTGTGCTTTGTGACAATGAGA    0.1   0.2  
100 ast-miR-989 21 TGTGATGTGACGTAGTGGTAC    4.5 2.1 0.5 55.1
101 ast-miR-993-3p 24 GAAGCTCGTTTCTATAGAGGTATC 4.4 2.3 6.7 9.2 14.7 28.5
102 ast-miR-993-5p 22 TACCCTGTAGTTCCGGGCTTTT 1.1 0.9 3.4 6.7 10.6 15.7
103 ast-miR-996 20 TGACTAGATTACATGCTCGT 68.8 6.5 149.5 199.4 175.1 315.8
104 ast-miR-998 21 TAGCACCATGAGATTCAGCTC 7.4   14.3 10.1 33.9 38.3
105 ast-miR-999 22 TGTTAACTGTAAGACTGTGTCT 210.0 24.9 440.1 609.1 2221.6 3492.3
106 ast-miR-9a 23 TCTTTGGTTATCTAGCTGTATGA 2025.1 406.1 1594.9 2663.9 321.4 1049.7
107 ast-miR-9c-3p 22 TAAAGCTTTAGTACCAGAGGTC 2.6   2.1 3.1 3.9 11.1
108 ast-miR-9c-5p 22 TCTTTGGTATTCTAGCTGTAGA 840.6 92.1 669.4 1056.2 366.8 1565.7
109 ast-miR-iab-4-3p 24 CGGTATACCTTCAGTATACGTAAC     0.1   
110 ast-miR-iab-4-5p 22 ACGTATACTGAATGTATCCTGA 3.3 0.3 2.3 2.6 1.7 2.2
111 ast-miR-iab-8-5p 20 TTACGTATACTGAAGGTATA    0.1 0.2 0.2 0.2