Skip to main content

Advertisement

Table 3 List of Novel miRNAs expressed and regulated across mosquito developmental stages

From: Dynamic expression of miRNAs across immature and adult stages of the malaria mosquito Anopheles stephensi

S. No Length Mature miRNA sequence Pre-miRNA sequence Novel miRNA Tags Per Million (TPM)
      LM LF PM PF AM AF
1 20 AGTCATTAATGATATTAGAC AUUUAUGGGAAAUAAUCUCUUUAAUCAGGCUUUAUAGUCAUUAAUGAUAUUAGACUGCAAUUCUAAAGGA AUAAUUUAAUUUAUUAAGGCUUAAGAAUUAAAAGAUUAAUACAAAUAUUUUCA ast-Novel-1-3p 0.37 0.00 0.06 0.05 0.08 0.00
2 21 ATAATTTAATTTATTAAGGCT AUUUAUGGGAAAUAAUCUCUUUAAUCAGGCUUUAUAGUCAUUAAUGAUAUUAGACUGCAAUUCUAAAGGA AUAAUUUAAUUUAUUAAGGCUUAAGAAUUAAAAGAUUAAUACAAAUAUUUUCA ast-Novel-1-5p    0.18 0.16 2.84 0.18
3 23 GTATTCAATTTGTATATCGTCGT GUUGGACCUUACUUAAAUUUGUAUUCAAUUUGUAUAUCGUCGUCAUCAGAAUAUAUUAUAAGAUUAAUAAUUUUCUAAAUAUUUUAUUAAAUAAUAUGUCAGGUCAAGGUGCAGUUUAUGUUUAAGUAG ast-Novel-2-3p    0.18 0.10 0.08  
4 19 ATTGATAATCCACGTTGGA GUUGGACCUUACUUAAAUUUGUAUUCAAUUUGUAUAUCGUCGUCAUCAGAAUAUAUUAUAAGAUUAAUAAUUUUCUAAAUAUUUUAUUAAAUAAUAUGUCAGGUCAAGGUGCAGUUUAUGUUUAAGUAG ast-Novel-2-5p 0.37   0.54 0.16 0.11  
5 24 TTAAGATTGGTATGATTAGCGTCT UUUCCUUUAAGAUUGGUAUGAUUAGCGUCUUGUUUAGCAGAAACUAAUCGUACUCCUUUU ast-Novel-3-3p     0.16 0.12 0.24
6 24 AAACTAATCGTACTCCTTTTGATT UUUCCUUUAAGAUUGGUAUGAUUAGCGUCUUGUUUAGCAGAAACUAAUCGUACUCCUUUU ast-Novel-3-5p      0.16  
7 18 AATGGGTAGTCGAAGATT AAUUGCUCAUGGUUUAUGUUCAUCUGGAUUAUUUUGUUUAGCUAAUAUUUCUUACGAACGAAUGGGUAGUCGAAGAUUAUUAAUUAAUAA ast-Novel-4-3p    6.00 0.47 0.16  
8 22 AATTGCTCATGGTTTATGTTCA AAUUGCUCAUGGUUUAUGUUCAUCUGGAUUAUUUUGUUUAGCUAAUAUUUCUUACGAACGAAUGGGUAGUCGAAGAUUAUUAAUUAAUAA ast-Novel-4-5p      0.3  
9 21 CGTAGTTTCTACATTAGGAGT UUUUACUUUUUUUGUAGGAUCAAUAUGAUUUAUACCCGUAGUUUCUACAUUAGGAGUAAU ast-Novel-5-3p    0.12 0.10 0.04  
10 21 ACTTTTTTTGTAGGATCAATA UUUUACUUUUUUUGUAGGAUCAAUAUGAUUUAUACCCGUAGUUUCUACAUUAGGAGUAAU ast-Novel-5-5p    0.60 0.42 0.56 0.18
11 25 TTTCGGATATGAATCAAAGTAATTT ACCACUUAAAUUUCGGAUAUGAAUCAAAGUAAUUUUCAUCAAUUCCCUCUACCCUCAUGAGCGAGUGAUGUAAUGUACUCUCGUUCUGGACGAUUUUCAACCACUUAAAU ast-Novel-6-3p 100.76 44.78 95.03 141.73 135.20 796.74
12 21 CGTTCTGGACGATTTTCAACC ACCACUUAAAUUUCGGAUAUGAAUCAAAGUAAUUUUCAUCAAUUCCCUCUACCCUCAUGAGCGAGUGAUGUAAUGUACUCUCGUUCUGGACGAUUUUCAACCACUUAAAU ast-Novel-6-5p 0.37     0.6  
13 23 AGCCGAACCAGCAGTACGAGTTT GACCCGACCGAGCCGAACCAGCAGUACGAGUUUUAACGCACGUUUCUUCGACUGGGAGCGUGGCGUCUCCUGUAACGCGGCUACUCGUGG ast-Novel-7-3p      0.04  
14 22 CGTCTCCTGTAACGCGGCTACT GACCCGACCGAGCCGAACCAGCAGUACGAGUUUUAACGCACGUUUCUUCGACUGGGAGCGUGGCGUCUCCUGUAACGCGGCUACUCGUGG ast-Novel-7-5p   0.28 0.30 0.31 0.04 0.18