Skip to main content

Table 1 Sequences of primers used to amplify long PCR fragments of Paramphistomum leydeni

From: Mitochondrial and nuclear ribosomal DNA dataset supports that Paramphistomum leydeni (Trematoda: Digenea) is a distinct rumen fluke species

Primer Sequence (5’-3’) Size (kb) Amplified region
Pl1F GCGGTATTGGCATTTTGTTGATTA ~3.5 Partial cox3-H-cytb-SNCR-nad4L-nad4
Pl2F GGAAGTTAGGTGTTTGGAATGTTG ~4.0 Partial atp6-nad2-V-A-D-nad1-N-P-I-K
Pl3F TTTTTTGGGCATAATGAGGTTTAT ~2.6 Partial cox1-T-rrnL-C-partial rrnS
Pl4F GGAGCAAGATACCTCGGGGATAA ~5.5 Partial rrnL-C-rrnS-cox2-nad6-Y-L1-S2-L2
Pl4R CCCACCTGGCTTACACTGGTCTTA   -R-nad5-G-E-LNCR-cox3-H-partial cytb