Skip to main content

Table 1 Primers of ovine beta-actin and five immune-relevant genes selected for quantitative RT-PCR validation

From: Profiling of differentially expressed genes in sheep T lymphocytes response to an artificial primary Haemonchus contortus infection

Acronym Gene name Primer sequence (5′ – 3′) GenBank number Product size (bp)
Beta-actin Beta-actin GGCAGGTCATCACCATCGGCAAT GCGTAGAGGTCTTTGCGGATGT U39357.1 151
IL-8 Interleukin 8 AAAAGTGGGTGCAGAAGG CTCAAGGCACTGAAGTAGAT NM_001009401.1 163
FCER1G Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide GACCCAGGAGACTTATGAGACC GCGTATGTGATGCCAACC NM_174537.2 123
IGLL1 immunoglobulin lambda-like polypeptide 1 CTCCAAACAGAGCAACAGC TGAGGGCTTCACTGTCTTC NM_001083800.1 136
CXCL2 chemokine (C-X-C motif) ligand 2 AGGACTTGATGTGCTGGACT CAGGACTGGGTTATGTTTG NM_174299.2 139
OVAR MHC class I antigen TGTTGCGGAGGCAGAAAGG ATGTGCCTTTGGAGGGTCTGC NM_001130934.1 112