Skip to main content

Table 1 Characteristics of the candidate reference genes and ionotropic receptor co-receptor primers

From: Evaluation of reference genes for insect olfaction studies

Gene Biological function Primer sequence (5’to 3’) Amplicon length (bp) Intron length (bp) R 2 E (%)
Act Cytoskeletal protein For- TGTCTCCCACACTGTACCCATCTA / 87 338 0.992 88.2%
Rev- TCGGTAAGATCACGACCAGCCAA
eIF-1a Protein biosynthesis For- TTGGAGGCCATGTGCTTTGAT / 94 183 0.999 91,3%
Rev-AGGTTTCTTGCTTCATCTGGAGT
GAPDH Glycolytic protein For- GACTGGCATGGCATTCAGAGTT / 182 1130 0.992 102.5%
Rev- CCCCATTAAAGTCCGATGACACC
GST Metabolism For- TACCCATCATTTGGCGTGGACA / 177 Intron - Exon junction 0.987 103.2%
Rev- CAAACCCAATTGCCTCAGCGAT
G6PDH Metabolism For- AGCCTGGAGAAGCGGTTTACGTTA / 162 923 0.998 96.5%
Rev- GTGAGCCACAGAATACGTCGAGT
SDH Metabolism For- TTGCCGGAGTAGATGTTACCAG / 147 1592 0.999 104.8%
Rev- CAGCTGCATAAAGTCCTTCCAC
Sp Metabolism For- AGGGACCATCTTTGACTGCTCTTC/ 157 Intron - Exon junction 0.996 98.8%
Rev- GAATCACCCTGGCAAGCATCTTTT
Tub Structural subunit of microtubules For- TGTGCCCAAGGATGTGAACG/ 118 202 0.991 110.9%
Rev- CACAGTGGGTGGTTGGTAGTTGAT
RproIR76b Ionotropic receptor co-receptor For- GCGTTTGCGTACCAAATGGACA / 113 1055 0.974 84.1%
Rev- GCGTCCGGTAGATCCAAAGTGATT
  1. Biological function; primer sequences; amplicon and intron lengths, R2: squared correlation coefficient (calculated from the regression line of the standard curve); E: quantitative real-time PCR efficiency (calculated by the standard method).