Skip to main content

Table 1 Primers used in the present study

From: Analysis of the complete Fischoederius elongatus (Paramphistomidae, Trematoda) mitochondrial genome

Primer codes Sequences (5′-3′) Target gene References
XCCOX3F AGYACDGTDGGDTTRCATTT cox31 Present study
XCCOX3R CANAYATAATCMACARAATGNCA cox31 Present study
nxccobF ATGTCWTWTTGRGCKGCBACNGT cytb1 Present study
nxccobR GADVCTCNGGRTGRCAVGCHCC cytb1 Present study
nxcND4F GAKTCBCCDTATTCDGARCG nad41 Present study
nxcND4R ACHCCNGCHGANANMCCRTGMCC nad41 Present study
TXCCOX1F GGHTGAACHRTWTAYCCHCC cox11 Present study
TXCCOX1R TGRTGRGCYCAWACDAYAMAHCC cox11 Present study
XC12SF AAWAAYGAGAGYGACGGGCG rrnS1 Present study
XC12SR TARACTAGGATTAGATACCC rrnS1 Present study
NxcND5F TGKTTGCBTCNCGNTTBGGNGATG nad51 Present study
NxcND5R TAACACTTRCANAHMCCRTGHGT nad51 Present study
3CF1 TGCATGTAGTGATAGGTTTGG cox3- cytb2 Present study
3CR1 AACTAACGTAACATTTGTCAC cox3- cytb2 Present study
3CF2 TTTGTTTTGTGGTTGCCTTC cytb-nad42 Present study
3CR2 AACGTAAATTAAACCTCCCCC cytb-nad42 Present study
3CF3 TGGCGTTTTTGAGTTTGTCTC nad4-cox12 Present study
3CR3 TCAACGAACTCAATATACTTG nad4-cox12 Present study
3CF4 TGGTTTCGGGGCTGTGAGAC cox1-rrnS2 Present study
3CR4 ACCAAGCAAAGAAAATTCTACC cox1-rrnS2 Present study
3CF5 TGTTAAAAGGCTTTGGTGTG rrnS-nad52 Present study
3CR5-1 ACCAACCAAACCTACACATC rrnS-nad52 Present study
3CF6-1 TTACGTTAGTTGGGTTGTTG nad5-cox32 Present study
3CR6 TTACATCTTTATAAAACACTTTC nad5-cox32 Present study
  1. 1 short regions amplified by PCR from cox3 (139 bp), cytb (613 bp), nad4 (554 bp), cox1 (497 bp), rrnS (500 bp) and nad5(458 bp). 2 large fragments that were amplified by long-range PCR from cox3-cytb (724 bp), cytb-nad4 (1008 bp), nad4-cox1 (4675 bp), cox1-rrnS (2198 bp), rrnS-nad5 (1981 bp) and nad5-cox3 (1718 bp)