Skip to main content

Table 1 Sequences of the primers used in this study

From: Anaplasma infection of Bactrian camels (Camelus bactrianus) and ticks in Xinjiang, China

Pathogen Target gene Primers Final amplicon size (bp) References
Primer name Oligonucleotide sequences (5′-3′)
Anaplasma & Ehrlichia 16S rRNA EC9 TACCTTGTTACGACTT 1462 [33]
EC12A TGATCCTGGCTCAGAACGAACG
A. bovis 16S rRNA AB1f CTCGTAGCTTGCTATGAGAAC 551 [33]
AB1r TCTCCCGGACTCCAGTCTG
A. phagocytophilum 16S rRNA SSAP2f GCTGAATGTGGGGATAATTTAT 641 [33]
SSAP2r ATGGCTGCTTCCTTTCGGTTA
A. marginale msp4 Amargmsp4 F CTGAAGGGGGAGTAATGGG 344 [34]
Amargmsp4 R GGTAATAGCTGCCAGAGATTCC
A. ovis msp4 Aovismsp4 F TGAAGGGAGCGGGGTCATGGG 347 [34]
Aovismsp4 R GAGTAATTGCAGCCAGGGACTCT
A. platys. 16S rRNA PLATYS F AAGTCGAACGGATTTTTGTC 506 [16]
PLATYS R CTTTAACTTACCGAACC
groEL PLA-HS475F AAGGCGAAAGAAGCAGTCTTA 724 [35]
PLAT-HS1198R CATAGTCTGAAGTGGAGGAC
gltA PLA-CSM136F TTGCAAAAAGTAAGCGGAGC 1459 [35]
PLA-CS1359R AACCACAGGCTTATGACAAC