Skip to main content

Table 1 The eleven pairs of primers used to amplify the Ae. aegypti sodium channel gene

From: Relationship between insecticide resistance and kdr mutations in the dengue vector Aedes aegypti in Southern China

Section Primer (5′-3′) Beginning nucleotide End nucleotide Length (bp) Tm
I GACAATGACCGAAGACTC 17 693 677 46 °C
ATGCTAATGCTATTACTACG
II GCGAGGTTTCATATTACAA 614 1262 649 49 °C
ACCCAAGAAGATAATCACAA
III CGTGGCACATGCTCTTCT 1222 1833 612 55 °C
TGACCGCGTTCGAGTCAT
IV CACAAGAACATTTGCCGTAC 1792 2401 610 53 °C
TCCTGGAACTTGAGCCAC
V GGCTCAAGTTCCAGGAGT 2386 3012 627 51 °C
CACCCACAAGCATACAATC
VI GTGGGATTGTATGCTTGTG 2990 3592 603 52 °C
ATGCCTCTATGATTCAGTTCGT
VII CCAAGGTGATAGGCAATT 3520 4156 637 51 °C
CAGGCGTTCGTAAAGTAAA
VIII CAAGTGGTTGGCGCTGGGTT 4112 4768 657 63 °C
CCGGCTTTCTTCTTCTGTTCGT
IX TTCATCATCTTCGGGTCG 4683 5326 644 52 °C
AAGAACAGCAGCAGACAGA
X GTCAAGGGTGCCAAAGGT 5238 5914 677 55 °C
TTCCGAGCGAAGAAGTCC
XI ACATACCGATCTGTCGAG 5830 6495 660 47 °C
ATTTCTGTCGTGCTTCTG