Skip to main content

Advertisement

Table 1 Sequence differences between two inverted repeats (IR) of the apicoplast genome of Cyclospora cayetanensis a

From: Genetic similarities between Cyclospora cayetanensis and cecum-infecting avian Eimeria spp. in apicoplast and mitochondrial genomes

Reference position Reference Alleleb Count Coverage (fold) Allele frequency (%) Mean read quality score
4096 C - 272 413 65.86 28.94
4098 A C 265 414 64.01 30.84
4100 A G 271 420 64.52 30.46
4117 G A 300 462 64.94 30.19
4136 G A 276 417 66.19 31.3
4142 A T 241 380 63.42 27.8
4149 C T 210 340 61.76 30.39
4153 A T 198 324 61.11 29.71
29970 T A 171 302 56.62 30.46
29974 G A 180 320 56.25 31.23
29981 T A 218 358 60.89 28.16
29987 C T 249 390 63.85 30.38
30006 C T 275 418 65.79 30.59
30023 T C 241 388 62.11 30.16
30025 T G 240 387 62.02 30.48
30027 G - 246 385 63.90 28.14
  1. aThe variable fragment is located in a 58-bp region (5′- CTATAACGGTCCAAAGGTAGCGAAATTCCTTGTCGGGTAAGTTCCGACCTGCACGAA-3′) of the LSU rRNA gene of each IR
  2. bDash indicates a nucleotide deletion