Genetic similarities between Cyclospora cayetanensis and cecum-infecting avian Eimeria spp. in apicoplast and mitochondrial genomes

Table 1 Sequence differences between two inverted repeats (IR) of the apicoplast genome of Cyclospora cayetanensis ^a

Reference position	Reference	Allele^b	Count	Coverage (fold)	Allele frequency (%)	Mean read quality score
4096	C	-	272	413	65.86	28.94
4098	A	C	265	414	64.01	30.84
4100	A	G	271	420	64.52	30.46
4117	G	A	300	462	64.94	30.19
4136	G	A	276	417	66.19	31.3
4142	A	T	241	380	63.42	27.8
4149	C	T	210	340	61.76	30.39
4153	A	T	198	324	61.11	29.71
29970	T	A	171	302	56.62	30.46
29974	G	A	180	320	56.25	31.23
29981	T	A	218	358	60.89	28.16
29987	C	T	249	390	63.85	30.38
30006	C	T	275	418	65.79	30.59
30023	T	C	241	388	62.11	30.16
30025	T	G	240	387	62.02	30.48
30027	G	-	246	385	63.90	28.14

^aThe variable fragment is located in a 58-bp region (5′- CTATAACGGTCCAAAGGTAGCGAAATTCCTTGTCGGGTAAGTTCCGACCTGCACGAA-3′) of the LSU rRNA gene of each IR
^bDash indicates a nucleotide deletion