Skip to main content

Advertisement

Table 2 Primer sequences for real-time and nested PCR protocols, along with sequence of positive control used for real time PCR reactions. Sequencing primers are also listed

From: A new real-time PCR protocol for detection of avian haemosporidians

Protocol/primer Primer sequence
Real-Time PCR – Haemoproteus, Plasmodium, Leucocytozoon
 R330Fa 5′- CGTTCTTAACCCAGCTCACG - 3′
 R480RLa 5′- GCCTGGAGGTWAYGTCC – 3′
P. relictum – Pos. Control 5′- GGGAACAAACTGCCTCAAGACGTTCTTAACCAGCT
 (Accession # NC012426) CACGCATCGCTTCTAACGGTGAACTCTCATTCCAA
TGGAACCTTGTTCAAGTTCAAATAGATTGGTAAGG
TATAGCGTTTACTATCGAATGAAACAATGTGTTCC
ACCGCTAGTGTTTGCTTCTAACATTCCATTGCTTAT
AACTGTATGGACGTAACCTCCAGGCAAAGAAAAT
GACCGGTC – 3′
Nested PCR – Haemoproteus and Plasmodium
 H332Fa 5′ - GAGAATTATGGAGYGGATGGTG - 3′
 HAEMNR2b 5′ - AGAGGTGTAGCATATCTATCTAC- 3′
 H350Fa 5′ – GGTGTTTTAGATATATGCATGC - 3′
 HAEMR2c 5′ - GCATTATCTGGATGTGATAATGGT - 3′
Nested PCR – Leucocytozoon  
 HAEMNFId 5′ - CATATATTAAGAGAAITATGGAG - 3′
 HAEMNR3d 5′ - ATAGAAAGATAAGAAATACCATTC - 3′
 L350Fe 5′ - GGTGTTTTAGATACTTA -3′
 L890Re 5′ - TACAATATGTTGAGGTGTTTG - 3′
Sequencing – Haemoproteus and Plasmodium
 FIFIf 5′ – GGGTCAAATGAGTTTCTGG - 3′
 R2f 5′ - GCTGTATCATACCCTAAAGG - 3′
Sequencing – Leucocytozoon  
 L545Fe 5′ - ACAAATGAGTTTCTGGGGA - 3′
 L825Re 5′ - GCAATTCCAAATAAACTTTGAA - 3′
  1. aDesigned for this study
  2. b[27]
  3. c[25]
  4. d[26]
  5. e[17]
  6. f[56]