Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Details on the primers used in the molecular tests

From: Parasitological, serological and molecular survey of Trypanosoma evansi infection in dromedary camels from Cholistan Desert, Pakistan

Name Specificity Target Primersequence Reference
TBR1/2 Trypanozoon Minichromosome satellite repetitive sequence TBR1-F:5’GAATATTAAACAATGCGCAG 3’ [38]
RoTat 1.2 Trypanosoma evansi type A RoTat 1.2 VSG RoTat-F:5’-GCGGGGTGTTTAAAGCAATA-3 [39]
Eva B Trypanosoma evansi type B Minicircle genes EVAB1-5’CACAGTCCGAGAGATAGAG-3 [57]