Skip to main content

Table 1 Primers used for Real-Time PCR

From: Evaluation of six novel antigens as potential biomarkers for the early immunodiagnosis of schistosomiasis

Primer Primer sequence (5′-3′)
SjSP-13 Forward CTGTCGTTTACTGTGTGG
SjSP-13 Reverse CCATTCTTCTTTTGGGAT
SjSP-23 Forward AAGGCGGTATGATTCC
SjSP-23 Reverse CCACGCACTCCTTGTTTTCTGA
SjSP-160 Forward GGCGGGCATGGATTTAGTTC
SjSP-160 Reverse GCTTGTAATGCCTTGC
SjSP-164 Forward TTCACACACCCTTGGG
SjSP-164 Reverse GTGATGGTGATGGTGATG
SjSP-189 Forward TTAGGGTTCCGATTTAGTGC
SjSP-189 Reverse CCGAGATAGGGTTGAGTGT
SjSP-216 Forward GGATGCTGGATGGAAAGC
SjSP-216 Reverse GAGGCCATTTCTTTCGTG
GAPDH Forward GTGTTCCTACCCCCAATGTGT
GAPDH Reverse GTCATACCAGGAAATGAGCTTGA
SOD Forward CTGATGACGGAAAGGGAG
SOD Reverse CTATGACACCACAAGCTACA