Skip to main content

Table 1 Primers / probe sequence design for the Dra1 RPA and LF assays

From: Isothermal Recombinase Polymerase amplification (RPA) of Schistosoma haematobium DNA and oligochromatographic lateral flow detection

Assay Name Sequence (5′-3′)
RPA Dra1-F1 ATCTCACCTATCAGACGAAACAAAGAAAAT
Dra1-R1 AATATGAAACAATTTTCACAACGATACGAC
LF-RPA Dra1-F1-LF ATCTCACCTATCAGACGAAACAAAGAAAAT
Dra1-R1-LF (Z)AATATGAAACAATTTTCACAACGATACGAC
Dra1 LF probe (Y)AATTGTTGGTGGAAGTGCCTGTTTCGCAAT(H)TCTCCGGAATGGTTG(3)
  1. Features: Z = Biotin label; Y = 6-carboxyfluorescein (FAM) label; H = abasic tetrahydrofuran (THF) residue; 3 = C3 spacer. All primers were designed according to the instructions from TwistDx (http://www.twistdx.co.uk). The Dra1 LF probe was designed with a recommended length of 46–52 bp with at least 30 bp placed 5′ to the abasic tetrahydrofuran (THF) residue (H). The RPA and LF RPA primers are the same but with a 5′ modification on the reverse primer (Dra1-R1-LF) for the LF RPA assay