Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study

From: Mosquito Rasputin interacts with chikungunya virus nsP3 and determines the infection rate in Aedes albopictus

Name Sequence
attB2-R-phos TCATACCCAGCTTTCTTGTAC
CHIKVnsP3-2R TCAGCGTGATGGCACGTTATGG
CHIKV nsP3-DDEL-R TCATAATTCGTCGTCCGTGTC
CHIKV nsP3-dUGA-R TCACCCACCTGCCCTATCTAGTAATTCGTCGTCCGTGTCTG
EGFP-R-phos CTTGTACAGCTCGTCCATG
EcoRI-nsP3-161-F CAAGTGGAATTACTAGACGAAC
nsP3-319-F GTTAGTCCAAGGGAATATAAATC
Aalb-Rin-F ATGGTAATGGAAGCACAACC
Aalb-Rin-R CTAACGTCGTCCTCCGTAG
Aalb-Rin-intF TCCAAGTGTCGCTACC
HindIII-EcoRI-Aalb-Rin-F GATAAGCTTGAATTCACCATGGTAATGGAAGCACAACC
HindIII-Aalb-Rin-R GATAAGCTTACGTCGTCCTCCGTAGG
nsP3-FG479AA F TAACGGCCGCGGATTTTGATGAAGGGGAGA
nsP3-FG479AA R AATCCGCGGCCGTTATGGGGAAAGTCTCGT
nsP3-FG497AA F TGACCGCTGCGGACTTCTCGCCGGGCGAAG
nsP3-FG497AA R GTCCGCAGCGGTCAGTAACTCAGAGGACAA
Rin-F34A F GCACCGTGCCTACAACAACTCGTCGAGCTTC
Rin-F34A R TGTTGTAGGCACGGTGCAGGTGATCCGGCG
Rin-F34A F GCACCGTTGGTACAACAACTCGTCGAGCTTC
Rin-F34A R TGTTGTACCAACGGTGCAGGTGATCCGGCG
T7-pGEM-Teasy-R TAATACGACTCACTATAGGGGCCGCGAATTCACTAGTG
Aalb-Rin F2 GTATGCCAACCATTGATCCG
Aalb-Rin R2 GTCCAGTTCGTTCATTGACAG
nsP1-int F CTGACGGAAGGTAGACGAG
nsP1-int R2 GCACGTGAAGCTGAGCTTCCC
S7 F CCAGGCTATCCTGGAGTTG
S7 R GACGTGCTTGCCGGAGAAC
nsP3-P398A F GAATACCGCGGCAGTCGCA
nsP3-P398A R TGCGACTGCCGCGGTATTC
nsP3-PPR401AAA F CGCCAGTCGCAGCGGCCGCAAGAAGACGTGGGAA
nsP3-PPR401AAA R CCCACGTCTTCTTGCGGCCGCTGCGACTGGCGCGGTAT