Skip to main content

Table 1 Characteristics of seven microsatellite loci on S. japonicum reported in the literature

From: Detecting genotyping errors at Schistosoma japonicum microsatellites with pedigree information

Locus Primer sequence (5’-3’) Repeat Schistosome isolates Number of alleles Size range (bp) He Reference
Sjp4 F: ACAAGCTCCAATCGTCTCTGA TAA Five provincesa, China 20 190-247 0.62–1.00 Yin, et al. [22]
  R: GAATACTGCCGCCCTTGTAA       
Sjp18 F: TCCTTTATCTGGGCTGTGGA TGA Two provincesb, China 7 261–298 0.68 Xiao, et al. [21]
  R: TTTCAGCAGGATAACATGACG       
Sjp22 F: CAAAGCCTAAACGTCATAGACAG TTA Two provincesb, China 11 105–167 0.85 Xiao, et al. [21]
  R: CAACCACCGATAAGTAGAGTGGA       
Sjp42 F: GCTGCAGCTTCTGTGTAGTAA TAA Two provincesb, China 9 199–234 0.95 Xiao, et al. [21]
  R: GTCTTGCTCAGATCAGTTCGT       
Sjp58 F: TCCCAGTACCAATGTAGATGTG AAT Two provincesb, China 12 439–499 0.8 Xiao, et al. [21]
  R: CTAATAAAGTCGTCAAGGAGCA       
Sjp60 F: CGATTCATTCATAGCCTGACT TAT Two provincesb, China 10 134–165 0.9 Xiao, et al. [21]
  R: GAATCCCATCACAGATTAACG       
TS2 F: TTGTCAATAATTTCACTAGGTTCAC GT The Philippines and two provincesc, China 5 360–385 0.68 Shrivastava, et al. [20]
  R: AATTAATAATTCACAAGTAAAACATCTAAGT       
  1. He, unbiased expected heterozygosity. aFive provinces are Anhui, Jiangxi, Hunan, Hubei and Sichuan. bTwo provinces are Anhui and Hubei.cTwo provinces are Anhui and Zhejiang