Skip to main content

Table 1 List of primers used in the study

From: Polymorphism in drug resistance genes dihydrofolate reductase and dihydropteroate synthase in Plasmodium falciparum in some states of India

Name of primers Sequence (5’- 3’) Expected size References
AMP-1 F TTTATATTTTCTCCTTTTTA 720 bp [18]
AMP-2R CATTTTATTATTCGTTTTCT
M1 TTTATGATGGAACAAGTCTGC 648 bp [38]
M5 AGTATATACATCGCTAACAGA
M3717F CCATTCCTCATGTGTATACAACAC 1287 bp [18]
186R GTTTAATCACATGTTTGCACTTTC
Rc GGTATTTTTGTTGAACCTAAACG 728 bp [38]
Rd ATCCAATTGTGTGATTTGTCCAC