Skip to main content

Table 1 List of PCR primer combinations used to amplify the mitochondrial genome of Phlebotomus chinensis

From: Mitochondrial genomes of two phlebotomine sand flies, Phlebotomus chinensis and Phlebotomus papatasi (Diptera: Nematocera), the first representatives from the family Psychodidae

Primer name Gene Sequence(5′–3′) Reference
1Fa(SR-J14610) rrnS ATAATAGGGTATCTAATCCTAGT [62]
1Ra(HCO2198) COI TAAACTTCAGGGTGACCAAAAAATCA [63]
2Fa(LCO1490) COI GGTCAACAAATCATAAAGATATTGG [63]
2Ra(C2-N3665) COII CCACAAATTTCTGAACATTG [62]
3F COII TTAGATGTCGATAACCGAAT This study
3R COIII AATGTAGTCCTTGAAATGTG This study
4F(C3-J4792) COIII GTTGATTATAGACCWTGRCC [62]
4R(TF-N6384) trnF TATATTTAGAGYATRAYAYTGAAG [62]
5Fa(TN-J6155) trnN TTTAATTGAARCCAAAAAGAGG [62]
5Ra(N4L-N9629) ND4L GTTTGTGAGGGWGYTTTRGG [62]
6F(N4-J9172) ND4 CGCTCAGGYTGRTACCCYCA [62]
6R(CB-N11010) Cytb TATCTACAGCRAATCCYCCYCA [62]
7Fa Cytb CTTGATCTATTGGAACATT This study
7Ra rrnL TACCTTAGGGATAACAGCG This study
8Fa(LR-J12888) rrnL CCGGTCTGAACTCARATCATGTA [62]
8Ra(SR-N14745) rrnS GTGCCAGCAGYYGCGGTTANAC [62]
  1. aThe PCR primers for the long PCR fragment (>2 kb)