Skip to main content

Table 1 Oligonucleotides used in this study

From: The mitochondrial genome of Angiostrongylus mackerrasae as a basis for molecular, epidemiological and population genetic studies

Oligonucleotide Sequence Position Reference
5 F-Mod TATATGAGCGTCATTTATTAGG nad1 This study
44R-Mod CTACCTTAATGTCCTCACGC rrnL This study
39 F TCTTAGCGTGAGGACATTAAG rrnL Hu et al., 2007 [8]
42R-Mod CCTAATAAATGACGCTCATAAG nad1 This Study