Skip to main content

Advertisement

Table 1 Oligonucleotide primer sequences and PCR reaction conditions for identification of Anopheles species and Wuchereria bancrofti

From: Transmission indices and microfilariae prevalence in human population prior to mass drug administration with ivermectin and albendazole in the Gomoa District of Ghana

Primer for species ID Sequence 5’  3’ PCR product size (bp) PCR conditions
Anopheles gambiae s.l. species
Universal primer GTGTGCCCCTTCCTCGATGT 468 93 °C 3’ followed by 35 cycles (93 °C 30”; 50 °C 30”; 72 °C 1’); 93 °C 30”; 50 °C 30”; 72 °C 10’
Anopheles gambiae s.s. CTGGTTTGGTCGGCACGTTT 390
Anopheles merus/ melax TGACCAACCCACTCCCTTGA 464
Anopheles arabiensis AAGTGTCCTTCTCCATCCTA 315
Anopheles quadrianulatus CAGACCAAGATGGTTAGTAT 153
Anopheles funestus s.l. species
Universal primer TGTGAACTGCAGGACACAT   30 cycles (94 °C 30”; 40 °C 30”; 72 °C 30”); 72 °C 10’
Anopheles funestus s.s. GCATCGATGGGTTAATCATG 460
Anopheles vaneedeni TGTCGACTTGGTAGCCGAAC 555
Anopheles rivulorum CAAGCCGTTCGACCCTGATT 400
Anopheles parensis TGCGGTCCCAAGCTAGGTTC 235
Anopheles leesoni TACACGGGCGCCATGTAGTT 146
Wuchereria bancrofti
NV-1 CGTGATGGCATCAAAGTAGCG 188 94 °C 3’; followed by 35 cycles (94 °C 1’; 55 °C 1’; 72 °C 2’); 94 °C 1’; 55 °C 1’; 72 °C 10”
NV-2 CCCTCACTTACCATAAGACAAC 188