Skip to main content

Table 1 Sequences of primers set used for detection of hemoparasites DNAs

From: Molecular detection and characterization of Babesia bovis, Babesia bigemina, Theileria species and Anaplasma marginale isolated from cattle in Kenya

Pathogen

Assays

Oligonucleotide sequences (5' > 3')

Product size (bp)

Reference

Target gene

B. bovis SBP-4

PCR

AGTTGTTGGAGGAGGCTAAT

907

[21]

TCCTTCTCGGCGTCCTTTTC

nPCR

GAAATCCCTGTTCCAGAG

503

TCGTTGATAACACTGCAA

B. bigemina RAP-1a

PCR

GAGTCTGCCAAATCCTTAC

879

TCCTCTACAGCTGCTTCG

nPCR

AGCTTGCTTTCACAACTCGCC

412

TTGGTGCTTTGACCGACGACAT

semi nPCR

GAGTCTGCCAAATCCTTAC

690

TTGGTGCTTTGACCGACGACAT

Theileria spp. 18S rRNA

PCR

GAAACGGCTACCACATCT

778

[20]

AGTTTCCCCGTGTTGAGT

nPCR

TTAAACCTCTTCCAGAGT

581

TCAGCCTTGCGACCATAC

T. parva p 104

PCR

ATTTAAGGAACCTGACGTGACTGC

496

[23]

TAAGATGCCGACTATTAATGACACC

nPCR

GGCCAAGGTCTCCTTCAGATTACG

277

TGGGTGTGTTTCCTCGTCATCTGC

T. orientalis MPSP

PCR

CTTTGCCTAGGATACTTCCT

776

[24]

ACGGCAAGTGGTGAGAACT

A. marginale Msp5

PCR

GTGTTCCTGGGGTACTCCTATGTGAACAAG

547

[22]

AAGCATGTGACCGCTGACAAACTTAAACAG

nPCR

AAGCACATGTTGGTAATATTCGGCTTCTCA

195

AATTCTCGCATCAAAAGACTTGTGGTACTC

  1. Note: The primers sets forSBP-4, 18S rRNA, p104 and MPSP genes were used for detection of corresponding pathogens and the products of the last amplification served as template for genetic characterisation. With regard to BbigRAP-1a and Msp5, PCR and nPCR primers were used in pathogen detection, however for genetic characterization, amplicons from a semi-nPCR (BbigRAP-1) and from the first PCR (Msp5) were used