Skip to main content

Table 1 Sequences of primers set used for detection of hemoparasites DNAs

From: Molecular detection and characterization of Babesia bovis, Babesia bigemina, Theileria species and Anaplasma marginale isolated from cattle in Kenya

Pathogen Assays Oligonucleotide sequences (5' > 3') Product size (bp) Reference
Target gene
B. bovis SBP-4 PCR AGTTGTTGGAGGAGGCTAAT 907 [21]
TCCTTCTCGGCGTCCTTTTC
nPCR GAAATCCCTGTTCCAGAG 503
TCGTTGATAACACTGCAA
B. bigemina RAP-1a PCR GAGTCTGCCAAATCCTTAC 879
TCCTCTACAGCTGCTTCG
nPCR AGCTTGCTTTCACAACTCGCC 412
TTGGTGCTTTGACCGACGACAT
semi nPCR GAGTCTGCCAAATCCTTAC 690
TTGGTGCTTTGACCGACGACAT
Theileria spp. 18S rRNA PCR GAAACGGCTACCACATCT 778 [20]
AGTTTCCCCGTGTTGAGT
nPCR TTAAACCTCTTCCAGAGT 581
TCAGCCTTGCGACCATAC
T. parva p 104 PCR ATTTAAGGAACCTGACGTGACTGC 496 [23]
TAAGATGCCGACTATTAATGACACC
nPCR GGCCAAGGTCTCCTTCAGATTACG 277
TGGGTGTGTTTCCTCGTCATCTGC
T. orientalis MPSP PCR CTTTGCCTAGGATACTTCCT 776 [24]
ACGGCAAGTGGTGAGAACT
A. marginale Msp5 PCR GTGTTCCTGGGGTACTCCTATGTGAACAAG 547 [22]
AAGCATGTGACCGCTGACAAACTTAAACAG
nPCR AAGCACATGTTGGTAATATTCGGCTTCTCA 195
AATTCTCGCATCAAAAGACTTGTGGTACTC
  1. Note: The primers sets forSBP-4, 18S rRNA, p104 and MPSP genes were used for detection of corresponding pathogens and the products of the last amplification served as template for genetic characterisation. With regard to BbigRAP-1a and Msp5, PCR and nPCR primers were used in pathogen detection, however for genetic characterization, amplicons from a semi-nPCR (BbigRAP-1) and from the first PCR (Msp5) were used