Skip to main content

Table 2 Primers used in nested PCR reactions in multilocus fragment typing of cattle-derived Cryptosporidium parvum

From: Development of a framework for genotyping bovine-derived Cryptosporidium parvum, using a multilocus fragment typing tool

Marker   Forward Reverse Reference
MM5 TCACAAGTTACCCCTTCTGATGCTG TCCACCTCCGGATTGGTTGTG [18]
CCTGGACTTGGATTTGGACTTACACC GGAGAAGATAAGCTAGCCGAATCT [12]
MM18 GTTCAGCTGATACGGGTTTGCAACA CATCACCATCTCCTCCGCCAGA [18]
CTTTCTGGAGGGTTTGTTCCTCC CTTCCTGATGATCCAGGCCAAGC [12]
MM19 TGGTTTTAGCTAAGGAAGCGATAG CTGCTGCTGCTGTTGCTTTA [18]
GATTCTGTCAACTTTGAATTCAG CCAACCCCGAATTCATTTCCAAC [12]
TP14 GAGAAGGAGCAATGGGAGCA TCCTCCTTTTTGCCCTTGAA [18]
CTAACGTTCACAGCCAACAGTACC CAATAAAGACCATTATTACCACC [20]
MS1 AAGGGTGAGGATGAGCAGAA TTCTTAACTTTCCATTTTGAGTGA Current study
TTAGTCGACCTCTTCAACAGTTGG GGAACACCATCCAAGAACCAAAGGT [26]
MS9 TTAGTCGACCTCTTCAACAGTTGG CAGAAT TGGAATCATTTTCTGAAT Current study
GGACTAGAAATAGAGCTTTGGCTGG GTCTGAGACAGAATCTAGGATCTAC [19]
gp60 ATAGTCTCCGCTGTATTC GAGATATATCTTGGTGCG [7]
TCCGCTGTATTCTCAGCC CGAACCACATTACAAATGAAG [7]