Skip to main content

Table 1 Target gene, primer combinations, amplified conditions used for PCR amplifications

From: Genetic characterization and molecular survey of Babesia bovis, Babesia bigemina and Babesia ovata in cattle, dairy cattle and yaks in China

Species Target gene PCR assay Primer name Sequence (5′-3′) Tm (°C) Product size (bp)
B. bovis rap-1a PCRa B.borap-1aF1/ B.borap-1aR1 ACGCGAATGGTTGCGTTTCAGA 55 570
GGCTCAGCAACATTGGCTTTCAG
nPCRa B.borap-1aF2/ B.borap-1aR2 GGTGATTACCACTACTTCGTCAC 55 394
CGTACGAGGTCAAGCTACCGAGCAG
PCRb B.borap-1afull-F/B.borap-1afull-R ATGAGAATCATTAGCGGCGTTGTCGGTT 64 1698
TCAGAGGTATCCGGCGGTGTCTTCACCG
nPCRb B.borap-1aseq-F/B.borap-1aseq-R TGTACGGATGCTTTACGATTGAC 59 1358
AGTTGAGTCGTTAGACTGAGTGGTA
B. bigemina rap-1c PCRa B.birap-1cF1/B.birap-1cR c AAGCAGCAGCCGTGGTACAAGCGTTGG 58 657
TTACGACGATCGTTTGAAGTACTTC
nPCRa B.birap-1cF2/B.birap-1cR c TGGCGAACTCGCAGACCAAGTAG 60 274
PCRb B.birap-1cF/B.birap-1cR c ATGATTCACTACGCTTGCCTCA 57 1530
nPCRb B.birap-1cseq-F/B.birap-1cR c TTACGCTGCTTACTACAGCTTCA 57 1054
B. ovata ama-1 PCRa B.ovama-1 F1/B.ovama-1R1 c GGCAGGTGCCTGCGTGGCGATCG 62 600
GAGCAACAACAGCGCCGTAGTAATCACG
nPCRa B.ovama-1 F2/ B.ovama-1R2 TGATATCGATATCGACCTTGATTC 62 310
GAGCTGTCACCATTGTCCTTAACAC
PCRb B.ovama-1seqF/B.ovama-1R1 c GATACGAGGCTGTCGGTAGC 62 1234
nPCRb B.ovama-1seqF/B.ovama-1R2 58 1041
  1. aFor screening analysis
  2. bFor sequencing analysis
  3. cbold data: The sequences of these primeres appeared twice or more times