Skip to main content

Table 1 Primers used for quantitative RT- PCR

From: SjCa8, a calcium-binding protein from Schistosoma japonicum, inhibits cell migration and suppresses nitric oxide release of RAW264.7 macrophages

Gene symbol Forward primer Reverse primer Ref.
Cat CCTCGTTCAGGATGTGGTTT GGCATCCCTGATGAAGAAAA [49]
Fas GCAGACATGCTGTGGATCTGG TCACAGCCAGGAGAATCGCAG [50]
Gadd45a CTGCCTCCTGGTCACGAA TTGCCTCTGCTCTCTTCACA [51]
Hmgb1 CCATTGGTGATGTTGCAAAG CTTTTTCGCTGCATCAGGTT [52]
Myc GAGGCGAACACACAACGTCTT CACGCAGGGCAAAAAAGC [53]
NOS2 AACCCCTTGTGCTGTTCTCAGCC GTGGACGGGTCGATGTCACATGC [54]
Sod2 ATGTTACAACTCAGGTCGCTCTTC TGATAGCCTCCAGCAACTCTCC [55]
Txnip CAAGTTCGGCTTTGAGCTTC GCCATTGGCAAGGTAAGTGT [56]
18S GTCTGTGATGCCCTTAGA AGCTTATGACCCGCACTTAC [57]