Skip to main content

Advertisement

Table 1 Details of the 18 selected microsatellite loci and the characteristics of the two multiplex microsatellite PCR assays. Loci Sh1-15 are from Travis et al., 2013 and Loci C102, C111 and C131 are from Gower et al., 2011. For Niger Ho = 0.596, He = 0.609, for Pemba Ho = 0.599, He = 0.638. The overall Ho = 0.597, He = 0.623

From: Erratum to: Development of novel multiplex microsatellite polymerase chain reactions to enable high-throughput population genetic studies of Schistosoma haematobium

Panel 1 Marker Forward Primer 5'- 3' Reverse Primer 5'- 3' Dye Size Range (bp) Repeat A Niger Zanzibar
  H o H e H o H e
Panel 1 C102 TGTCTCTGTGAATGACCGAAT TTAGATGAATAATAATGTTGAAACCAC VIC 184-199 ATT 6 0.42 0.37 0.02 0.02
Sh1 GCATCCAATTTCGTACAC CCACATTAGGCCAACAAG VIC 245-284 AAT 13 0.76 0.72 0.84 0.80
Sh14 GTCCTCCTTCCCTCTTTG CACATTCGTCCTAGATATCG NED 184-240 ACTC 15 0.94 0.85 0.86 0.88
C131 CTTGTCATTTGGGCATTGTG CATGGTGAGGTTCAAACGTG NED 253-265 AAT 4 0.00 0.00 0.00 0.00
Sh6 GGTGGATTACGCAATAG TTTAATCAACCGGGTGTC NED 309-321 AAT 7 0.48 0.44 0.84 0.76
Sh9 GGGATGTATGCAGACTTG TTGTTTGGCTGCAGTAAC 6-FAM 197-227 AAT 11 0.46 0.76 0.46 0.86
Sh3 GCTGAGCTTGAGATTG CTTCTGTCCCATCGATACC 6-FAM 270-366 AAT 30 0.76 0.86 0.94 0.86
C111 CCCTTGTCTTCAATGCGTTA GAACGTCTAACTGGCGATCA PET 201-225 ATT 9 0.74 0.67 0.76 0.68
Sh7 TCCAAGCACCATTATCAAG ACGGAAACTTGTTGAAATG PET 293-311 AAT 7 0.46 0.62 0.42 0.48
Panel 2 Sh2 TTAGTGTGTTTGGCTTCAAC CCTCGAATGAAATCCTGAC NED 155-218 AAT 21 0.84 0.90 0.56 0.89
Sh5 TGTGCACAAGAAAGATTAAATG ACGACAATGTTGCAAGTTC NED 263-314 AAT 16 0.78 0.81 0.36 0.48
Sh13 GAGCAGCTATTTCGTATCG ACCGTGGACAGTTCATCAG 6-FAM 163-211 AAT 17 0.78 0.72 0.68 0.64
Sh4 CCCATCGCTGATATTAAAG TCTAGTCGTCTTGGGATCC 6-FAM 268-313 AAT 13 0.84 0.78 0.72 0.79
Sh10 CGCATGTCATACCTATCTCC GCTTATCAGGCCTATCTCC PET 183-207 AAT 9 0.18 0.34 0.74 0.70
Sh12 CGTCTTAGTGAGCCAGATG CTCGTGGACATCATCAG PET 245-278 AAC 11 0.06 0.06 0.56 0.65
Sh8 CTAAACTGGCAAGATTTC CAACGTGCCTTTATTTC PET 282-321 AAT 14 0.76 0.81 0.84 0.83
Sh11 TTGGTTTAGAAATTACATCACC CCAACAATATTAATGGACAGC VIC 183-213 ATC 9 0.68 0.58 0.68 0.69
Sh15 CTTTCAGTAGGATTTGTTG CGACGTCAAGCACTGTAC VIC 274-301 ATC 10 0.78 0.65 0.50 0.466
  1. Panel = single mulitplex PCR. A = observed number of alleles. Dye = the fluorescent dye label of the forward primer (VIC = green, NED = yellow, 6-FAM = Blue, PET = red). Ho = observed heterozygosity, He = expected heterozygosity