Skip to main content

Table 1 The Primers used in real-time PCR

From: Differential sialotranscriptomes of unfed and fed Rhipicephalus haemaphysaloides, with particular regard to differentially expressed genes of cysteine proteases

Target gene Forward primer (5′-3′) Reverse primer(5'-3') GeneBank number
CAT B GCACCACCATTGGCGAGATTC CTCGTAGTTGCCGCCCGTG KT194088
CAT L CTGAGGGCTTTGAGGATTTGC GACCACCCTCGCAGCCG KT194089
ATG4B GGCACCTTGGGAAAGACTGGC GCGTCTGTTGTCTCCACTCTGCAT KT194090
ATG4D AAGCAGGCGGGTGACTGGTAT AATGTATGTGGTGTTGAGCTGTTCC KT194091
CASP1 TCCACGGTGCCAGGCTTCTAC CCAGTCGGGTCAGAGTGGAGGAG KT194092
CASP8 GCAGGCACGCTCTACCAGTC GCTCCTCTCATACAGCAGCACTA KT194093