Table 1 Primer purposes and sequences, gene region and PCR product size for Rhipicephalus microplus Cox1 and RmAQP2
Primer purpose | Forward primer | Reverse primer | Gene region | Product size (bp) |
|---|---|---|---|---|
Cox1 amplification external | attttaccgcgatgaatatactc | gcaaggcctaaaaaatg | 1 to 1298 | 1298 |
Cox1 amplification nested primers | ctcaactaatcataaagacattgg | gctaatataattcctgttaaacctcc | 21 to 1072 | 1052 |
RmAQP2 dsRNA synthesis | aattcagcagcaggagaagc | cggcgtacaccaggtaaact | 17 to 414 | 397 |
RmAQP2 dsRNA synthesis | cctctcctcgtcggcctca | cggctaaaacgcaaaaaggt | 614 to 1009 | 396 |
RmAQP2 Real-time PCR | gtaagtcaccgcacagta | tacacaatagcgaggtt | 349 to 453 | 105 |