Skip to main content

Table 1 Primer purposes and sequences, gene region and PCR product size for Rhipicephalus microplus Cox1 and RmAQP2

From: Targeted silencing of the Aquaporin 2 gene of Rhipicephalus (Boophilus) microplus reduces tick fitness

Primer purpose Forward primer Reverse primer Gene region Product size (bp)
Cox1 amplification external attttaccgcgatgaatatactc gcaaggcctaaaaaatg 1 to 1298 1298
Cox1 amplification nested primers ctcaactaatcataaagacattgg gctaatataattcctgttaaacctcc 21 to 1072 1052
RmAQP2 dsRNA synthesis aattcagcagcaggagaagc cggcgtacaccaggtaaact 17 to 414 397
RmAQP2 dsRNA synthesis cctctcctcgtcggcctca cggctaaaacgcaaaaaggt 614 to 1009 396
RmAQP2 Real-time PCR gtaagtcaccgcacagta tacacaatagcgaggtt 349 to 453 105