Skip to main content

Advertisement

Table 1 List of PCR primers used for the synthesis of double-stranded RNA

From: Virucidal activity of Haemaphysalis longicornis longicin P4 peptide against tick-borne encephalitis virus surrogate Langat virus

Primer name Primer sequence
Longicin RNAi forward CCTCATCTTCGTCCTTGTAG
Longicin RNAi reverse ATTATGACGACACACATAAT
Longicin T7 forward GGATCCTAATACGACTCACTATAGGCCTCATCTTCGTCCTTGTAG
Longicin T7 reverse GGATCCTAATACGACTCACTATAGGATTATGACGACACACATAAT
Luc T7 forward GTAATACGACTCACTATAGGGCTTCCATCTTCCAGGGATACG
Luc T7 reverse GTAATACGACTCACTATAGGCGTCCACAAACACAACTCCTCC