Skip to main content

Advertisement

Table 2 List of PCR primers used for the detection of longicin gene

From: Virucidal activity of Haemaphysalis longicornis longicin P4 peptide against tick-borne encephalitis virus surrogate Langat virus

Primer name Primer sequence
Longicin forward ATGAAGGTCCTGGCTGTTGC
Longicin reverse CTACTTGCGGTAGCACGTGC
Hlβ-actin forward ATCCTGCGTCTCGACTTGG
Hlβ-actin reverse GCCGTGGTGGTGAAAGAGTAG