Skip to main content

Table 3 List of real-time PCR primers used for the determination of longicin gene silencing efficiency

From: Virucidal activity of Haemaphysalis longicornis longicin P4 peptide against tick-borne encephalitis virus surrogate Langat virus

Primer name Primer sequence
Longicin real-time forward ACATGAAGGTCCTGGCTGTTG
Longicin real-time reverse TCTCGTCATCTTGAGCTGCTG
L23 real-time forward CACACTCGTGTTCATCGTCC
L23 real-time reverse ATGAGTGTGTTCACGTTGGC