Skip to main content

Table 2 LAMP primer sequences. F3, forward outer primer; B3, reverse outer primer; FIP, forward inner primer (comprising F1c and F2 sequences); BIP, reverse inner primer (comprising B1c and B2 sequences)

From: Loop-mediated isothermal amplification (LAMP) assay for the diagnosis of fasciolosis in sheep and its application under field conditions

Primers Sequence (5’-3’)
F3 GCTGGCGTGATCTCCTCTA
B3 AACGTGCCTGGTATGGAATT
FIP (F1c-F2) TCTGCCAAGACAAGGGTGCAT-GTGAGGTGCCAGATCTATGG
BIP (B1c-B2) GTGCAGTGGCGGAATCGTGG-TGTGCCGACTAGGGGATC