Skip to main content

Table 1 Primers used in the study, annealing temperatures used in the PCRs and expected sizes of the PCR products

From: Prevalence, risk factors and multilocus genotyping of Enterocytozoon bieneusi in farmed foxes (Vulpes lagopus), Northern China

Gene Primer Sequence (5′-3′) Annealing temperature (°C) Fragment length (bp) References
ITS F1 GGTCATAGGGATGAAGAG 55 392 13
R1 TTCGAGTTCTTTCGCGCTC
F2 GCTCTGAATATCTATGGCT 55
R2 ATCGCCGACGGATCCAAGTG
MS1 F1 CAAGTTGCAAGTTCAGTGTTTGAA 58 675 13
R1 GATGAATATGCATCCATTGATGTT
F2 TTGTAAATCGACCAAATGTGCTAT 58
R2 GGACATAAACCACTAATTAATGTAAC
MS3 F1 CAAGCACTGTGGTTACTGTT 55 537 13
R1 AAGTTAGGGCATTTAATAAAATTA
F2 GTTCAAGTAATTGATACCAGTCT 55
R2 CTCATTGAATCTAAATGTGTATAA
MS4 F1 GCATATCGTCTCATAGGAACA 55 885 13
R1 GTTCATGGTTATTAATTCCAGAA
F2 CGAAGTGTACTACATGTCTCT 55
R2 GGACTTTAATAAGTTACCTATAGT
MS7 F1 GTTGATCGTCCAGATGGAATT 55 471 13
R1 GACTATCAGTATTACTGATTATAT
F2 CAATAGTAAAGGAAGATGGTCA 55
R2 CGTCGCTTTGTTTCATAATCTT