Skip to main content

Table 2 List of primers used

From: Vector competence of Aedes vexans (Meigen), Culex poicilipes (Theobald) and Cx. quinquefasciatus Say from Senegal for West and East African lineages of Rift Valley fever virus

Nom Segment Position Sequence Tm
NSng S 31–48 TATCATGGATTACTTTCC 48
NSca S 841–824 CCTTAACCTCTAATCAAC 50
M1F M 3–22 ACAAAGACCGGTGCAACTTC 53.9
M1R M 1120–1140 CCAYGCAAAGGGTATGCAAT 53.2
M2F M 1035–1054 TGAGGACTCTGAATTRCACCT 48.7
M2R M 2395–2415 TCCAGAGAGTTGAGCCTTGC 53.3
MRV1a M 3050–3068 CAAATGACTACCAGTCAGC 44.6
MRV2g M 2262–2292 GGTGGAAGGACTCTGCGA 52.5
M3F M 2979–2998 CAGTCCTCAGTGAGCYCATA 46.1
M3R M 3763–3782 TCTCGGTTCTGGRGTGTGAA 52.5